Multiple sequence alignment - TraesCS3B01G121600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G121600 chr3B 100.000 2723 0 0 1 2723 92201097 92203819 0 5029
1 TraesCS3B01G121600 chr5B 98.972 2724 27 1 1 2723 679660393 679663116 0 4874
2 TraesCS3B01G121600 chr7B 98.935 2724 28 1 1 2723 743087695 743090418 0 4868
3 TraesCS3B01G121600 chr5A 98.862 2724 29 2 1 2722 300074475 300077198 0 4857
4 TraesCS3B01G121600 chr5A 98.825 2724 31 1 1 2723 16601427 16598704 0 4852
5 TraesCS3B01G121600 chr5A 97.912 2730 49 4 1 2723 600278241 600275513 0 4719
6 TraesCS3B01G121600 chr6A 98.789 2724 32 1 1 2723 289130126 289132849 0 4846
7 TraesCS3B01G121600 chr7D 98.679 2725 33 3 2 2723 203554849 203552125 0 4830
8 TraesCS3B01G121600 chr2A 98.532 2724 37 3 1 2723 735194150 735196871 0 4806


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G121600 chr3B 92201097 92203819 2722 False 5029 5029 100.000 1 2723 1 chr3B.!!$F1 2722
1 TraesCS3B01G121600 chr5B 679660393 679663116 2723 False 4874 4874 98.972 1 2723 1 chr5B.!!$F1 2722
2 TraesCS3B01G121600 chr7B 743087695 743090418 2723 False 4868 4868 98.935 1 2723 1 chr7B.!!$F1 2722
3 TraesCS3B01G121600 chr5A 300074475 300077198 2723 False 4857 4857 98.862 1 2722 1 chr5A.!!$F1 2721
4 TraesCS3B01G121600 chr5A 16598704 16601427 2723 True 4852 4852 98.825 1 2723 1 chr5A.!!$R1 2722
5 TraesCS3B01G121600 chr5A 600275513 600278241 2728 True 4719 4719 97.912 1 2723 1 chr5A.!!$R2 2722
6 TraesCS3B01G121600 chr6A 289130126 289132849 2723 False 4846 4846 98.789 1 2723 1 chr6A.!!$F1 2722
7 TraesCS3B01G121600 chr7D 203552125 203554849 2724 True 4830 4830 98.679 2 2723 1 chr7D.!!$R1 2721
8 TraesCS3B01G121600 chr2A 735194150 735196871 2721 False 4806 4806 98.532 1 2723 1 chr2A.!!$F1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
314 320 1.703513 AGTTAGGGCTTCGGTTTCCTT 59.296 47.619 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2076 2084 1.54995 GGAGGGAAACTTGCCATTCCA 60.55 52.381 2.63 0.0 45.64 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 127 8.677148 AAGTGAGTTCATTGTTGTTGTATAGT 57.323 30.769 0.00 0.00 0.00 2.12
231 237 7.508687 AGCCAAAGAAAACTTAAATCCATTGT 58.491 30.769 0.00 0.00 0.00 2.71
314 320 1.703513 AGTTAGGGCTTCGGTTTCCTT 59.296 47.619 0.00 0.00 0.00 3.36
464 470 1.839994 TGGTAGAAGATTGGGCTCTGG 59.160 52.381 0.00 0.00 0.00 3.86
496 502 7.621683 AGATCCACTCAACTAGGAAAGAAGTAT 59.378 37.037 0.00 0.00 34.62 2.12
726 732 4.094442 GTGACTAAGGAGGCCGTAAAAATG 59.906 45.833 0.00 0.00 0.00 2.32
807 813 2.365237 GTAAGAGGGGACGGGCCT 60.365 66.667 0.84 0.00 36.66 5.19
984 990 3.629398 AGTCTTTCTTGTTCCACTTGCAG 59.371 43.478 0.00 0.00 0.00 4.41
1154 1161 5.445069 TCTTCAACAAGGTGGAAATTCTCA 58.555 37.500 0.00 0.00 0.00 3.27
1243 1250 4.583073 ACAGTTCCTTGTTCCCATTAACAC 59.417 41.667 0.00 0.00 39.02 3.32
1457 1464 1.276989 TGTCGAACCGGCTCCTATTTT 59.723 47.619 0.00 0.00 30.55 1.82
1618 1625 3.246021 TGCTAACTTCCCCTTCTCTACCT 60.246 47.826 0.00 0.00 0.00 3.08
1897 1904 7.566509 GGGAAAGAAGGTAGTATAGGGAACTTA 59.433 40.741 0.00 0.00 43.67 2.24
2002 2009 6.497259 AGTGTGAAAATCCTTAGTCACTAGGA 59.503 38.462 0.00 0.75 40.81 2.94
2315 2325 7.811713 CAGTCTTTTTCCTTTCTTTGATGATCC 59.188 37.037 0.00 0.00 0.00 3.36
2358 2368 2.354103 CCTGCGAGTGAAGGATTTCTCA 60.354 50.000 0.00 0.00 44.93 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 127 4.528596 TGGTTTTGTCAAGGAAAGGTTTCA 59.471 37.500 4.89 0.00 38.92 2.69
231 237 6.572509 GCTGTAGAGTCACTGGTTTCTAATCA 60.573 42.308 0.00 0.00 0.00 2.57
314 320 5.860941 TTTGGAATTGAAACTGGCTACAA 57.139 34.783 0.00 0.00 0.00 2.41
464 470 2.656560 AGTTGAGTGGATCTGCGTAC 57.343 50.000 0.00 0.00 0.00 3.67
496 502 1.971481 AACAGTCAGTCAGCAATGCA 58.029 45.000 8.35 0.00 0.00 3.96
879 885 4.021456 CGGAATTCCCCTTGCTTAGTTTTT 60.021 41.667 19.01 0.00 0.00 1.94
984 990 5.793817 ACTGACATTTTATTTTCCTTGCCC 58.206 37.500 0.00 0.00 0.00 5.36
1070 1077 3.181530 CGCTGTTAAGAACAACCGAGATG 60.182 47.826 6.32 0.00 41.61 2.90
1154 1161 6.145534 CGCAGGAACATGTACATACGAAATAT 59.854 38.462 8.32 0.00 0.00 1.28
1243 1250 2.558359 AGCGAAGAAAAAGGGGATGTTG 59.442 45.455 0.00 0.00 0.00 3.33
1618 1625 5.235616 GTGTTTCCAGAACGAACAAGATACA 59.764 40.000 0.00 0.00 35.31 2.29
1897 1904 7.979444 TCACTTTCGATAAGAATCCAAAAGT 57.021 32.000 12.35 7.31 41.11 2.66
2002 2009 3.140325 TGTTCCCATCGAGCTTTCTTT 57.860 42.857 0.00 0.00 0.00 2.52
2076 2084 1.549950 GGAGGGAAACTTGCCATTCCA 60.550 52.381 2.63 0.00 45.64 3.53
2315 2325 6.039047 CAGGGAATTCAAATAGATGTGTGGAG 59.961 42.308 7.93 0.00 0.00 3.86
2358 2368 4.878397 CGCTCAAGAGGTTTTTCTCCATAT 59.122 41.667 0.00 0.00 34.46 1.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.