Multiple sequence alignment - TraesCS3B01G121500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G121500 chr3B 100.000 2319 0 0 1 2319 92199603 92201921 0 4283
1 TraesCS3B01G121500 chr5A 99.139 2322 17 3 1 2319 300072978 300075299 0 4174
2 TraesCS3B01G121500 chr5A 98.664 2321 26 4 1 2319 16602920 16600603 0 4109
3 TraesCS3B01G121500 chr2A 99.053 2322 19 3 1 2319 618279957 618277636 0 4163
4 TraesCS3B01G121500 chr6A 98.966 2321 21 3 1 2319 289128631 289130950 0 4150
5 TraesCS3B01G121500 chrUn 98.923 2322 22 3 1 2319 189392538 189394859 0 4146
6 TraesCS3B01G121500 chr7B 98.837 2322 24 3 1 2319 743086198 743088519 0 4135
7 TraesCS3B01G121500 chr7D 98.665 2322 28 3 1 2319 626698491 626696170 0 4113
8 TraesCS3B01G121500 chr7D 98.621 2321 30 2 1 2319 203556346 203554026 0 4108
9 TraesCS3B01G121500 chr7A 98.495 2326 28 3 1 2319 4959837 4962162 0 4095


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G121500 chr3B 92199603 92201921 2318 False 4283 4283 100.000 1 2319 1 chr3B.!!$F1 2318
1 TraesCS3B01G121500 chr5A 300072978 300075299 2321 False 4174 4174 99.139 1 2319 1 chr5A.!!$F1 2318
2 TraesCS3B01G121500 chr5A 16600603 16602920 2317 True 4109 4109 98.664 1 2319 1 chr5A.!!$R1 2318
3 TraesCS3B01G121500 chr2A 618277636 618279957 2321 True 4163 4163 99.053 1 2319 1 chr2A.!!$R1 2318
4 TraesCS3B01G121500 chr6A 289128631 289130950 2319 False 4150 4150 98.966 1 2319 1 chr6A.!!$F1 2318
5 TraesCS3B01G121500 chrUn 189392538 189394859 2321 False 4146 4146 98.923 1 2319 1 chrUn.!!$F1 2318
6 TraesCS3B01G121500 chr7B 743086198 743088519 2321 False 4135 4135 98.837 1 2319 1 chr7B.!!$F1 2318
7 TraesCS3B01G121500 chr7D 626696170 626698491 2321 True 4113 4113 98.665 1 2319 1 chr7D.!!$R2 2318
8 TraesCS3B01G121500 chr7D 203554026 203556346 2320 True 4108 4108 98.621 1 2319 1 chr7D.!!$R1 2318
9 TraesCS3B01G121500 chr7A 4959837 4962162 2325 False 4095 4095 98.495 1 2319 1 chr7A.!!$F1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
213 214 0.909623 CTGGTGGTATTTCCCGAGGT 59.09 55.0 0.0 0.0 34.77 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1990 2002 1.971481 AACAGTCAGTCAGCAATGCA 58.029 45.0 8.35 0.0 0.0 3.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 7.425606 GTTCTTTGAGCAAAAAGATAAGGTCA 58.574 34.615 12.86 0.0 43.75 4.02
213 214 0.909623 CTGGTGGTATTTCCCGAGGT 59.090 55.000 0.00 0.0 34.77 3.85
250 251 3.876914 GCATTCATATCGGTCAGGAAACA 59.123 43.478 0.00 0.0 0.00 2.83
891 895 1.562475 TCCCCTTTTTACCCATCGGAG 59.438 52.381 0.00 0.0 0.00 4.63
941 947 2.168496 CTTTCACAGTCCCCTACGAGA 58.832 52.381 0.00 0.0 0.00 4.04
1381 1388 0.526524 CGCAAAACCGGCAAACTCAA 60.527 50.000 0.00 0.0 0.00 3.02
1615 1627 8.677148 AAGTGAGTTCATTGTTGTTGTATAGT 57.323 30.769 0.00 0.0 0.00 2.12
1725 1737 7.508687 AGCCAAAGAAAACTTAAATCCATTGT 58.491 30.769 0.00 0.0 0.00 2.71
1808 1820 1.703513 AGTTAGGGCTTCGGTTTCCTT 59.296 47.619 0.00 0.0 0.00 3.36
1958 1970 1.839994 TGGTAGAAGATTGGGCTCTGG 59.160 52.381 0.00 0.0 0.00 3.86
1990 2002 7.621683 AGATCCACTCAACTAGGAAAGAAGTAT 59.378 37.037 0.00 0.0 34.62 2.12
2220 2232 4.094442 GTGACTAAGGAGGCCGTAAAAATG 59.906 45.833 0.00 0.0 0.00 2.32
2301 2313 2.365237 GTAAGAGGGGACGGGCCT 60.365 66.667 0.84 0.0 36.66 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 4.695928 GCAAAGAAAGAACTCCGGTATTCT 59.304 41.667 14.72 14.72 36.73 2.40
213 214 4.233632 TGAATGCACATATTGACCCTCA 57.766 40.909 0.00 0.00 0.00 3.86
250 251 4.757149 CCGGAAAGAAGAAGAGTCATTGTT 59.243 41.667 0.00 0.00 0.00 2.83
891 895 4.499183 AGGAGATCAAAATGTGAGTCGAC 58.501 43.478 7.70 7.70 40.43 4.20
941 947 1.284785 TCCTTCATTGATTCCGGGCTT 59.715 47.619 0.00 0.00 0.00 4.35
1381 1388 2.910688 TTCACTTTCAGAGACCGCTT 57.089 45.000 0.00 0.00 0.00 4.68
1615 1627 4.528596 TGGTTTTGTCAAGGAAAGGTTTCA 59.471 37.500 4.89 0.00 38.92 2.69
1725 1737 6.572509 GCTGTAGAGTCACTGGTTTCTAATCA 60.573 42.308 0.00 0.00 0.00 2.57
1808 1820 5.860941 TTTGGAATTGAAACTGGCTACAA 57.139 34.783 0.00 0.00 0.00 2.41
1958 1970 2.656560 AGTTGAGTGGATCTGCGTAC 57.343 50.000 0.00 0.00 0.00 3.67
1990 2002 1.971481 AACAGTCAGTCAGCAATGCA 58.029 45.000 8.35 0.00 0.00 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.