Multiple sequence alignment - TraesCS3B01G121400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G121400 chr3B 100.000 2300 0 0 1 2300 92147456 92145157 0.000000e+00 4248
1 TraesCS3B01G121400 chr3B 98.653 2301 30 1 1 2300 92266388 92264088 0.000000e+00 4076
2 TraesCS3B01G121400 chr3B 98.521 2299 32 1 1 2297 5082608 5084906 0.000000e+00 4056
3 TraesCS3B01G121400 chr3B 97.388 2297 58 2 1 2297 575735302 575737596 0.000000e+00 3908
4 TraesCS3B01G121400 chr3B 95.460 881 36 2 1 878 39820054 39820933 0.000000e+00 1402
5 TraesCS3B01G121400 chr3B 96.850 381 11 1 1582 1962 532671746 532671367 8.960000e-179 636
6 TraesCS3B01G121400 chr3B 97.727 88 2 0 29 116 630292761 630292674 3.960000e-33 152
7 TraesCS3B01G121400 chr3B 95.122 82 4 0 1305 1386 42938139 42938058 1.850000e-26 130
8 TraesCS3B01G121400 chr3B 91.860 86 6 1 1860 1945 591831572 591831488 4.010000e-23 119
9 TraesCS3B01G121400 chr1B 99.043 2298 21 1 1 2297 683729610 683731907 0.000000e+00 4120
10 TraesCS3B01G121400 chr6B 98.783 2301 27 1 1 2300 128916648 128914348 0.000000e+00 4093
11 TraesCS3B01G121400 chr7B 98.696 2301 29 1 1 2300 698144693 698142393 0.000000e+00 4082
12 TraesCS3B01G121400 chr2A 98.609 2301 31 1 1 2300 563261173 563258873 0.000000e+00 4071


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G121400 chr3B 92145157 92147456 2299 True 4248 4248 100.000 1 2300 1 chr3B.!!$R2 2299
1 TraesCS3B01G121400 chr3B 92264088 92266388 2300 True 4076 4076 98.653 1 2300 1 chr3B.!!$R3 2299
2 TraesCS3B01G121400 chr3B 5082608 5084906 2298 False 4056 4056 98.521 1 2297 1 chr3B.!!$F1 2296
3 TraesCS3B01G121400 chr3B 575735302 575737596 2294 False 3908 3908 97.388 1 2297 1 chr3B.!!$F3 2296
4 TraesCS3B01G121400 chr3B 39820054 39820933 879 False 1402 1402 95.460 1 878 1 chr3B.!!$F2 877
5 TraesCS3B01G121400 chr1B 683729610 683731907 2297 False 4120 4120 99.043 1 2297 1 chr1B.!!$F1 2296
6 TraesCS3B01G121400 chr6B 128914348 128916648 2300 True 4093 4093 98.783 1 2300 1 chr6B.!!$R1 2299
7 TraesCS3B01G121400 chr7B 698142393 698144693 2300 True 4082 4082 98.696 1 2300 1 chr7B.!!$R1 2299
8 TraesCS3B01G121400 chr2A 563258873 563261173 2300 True 4071 4071 98.609 1 2300 1 chr2A.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
840 843 8.36039 GTTTCCAAAAACTACCATGAAATCTCT 58.64 33.333 0.0 0.0 41.32 3.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2153 2159 0.325296 TAGGGCGAGACAGAATGGGT 60.325 55.0 0.0 0.0 43.62 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
388 389 9.219603 CAAATCCACACAGACTATTTTCTCTAA 57.780 33.333 0.00 0.00 0.00 2.10
840 843 8.360390 GTTTCCAAAAACTACCATGAAATCTCT 58.640 33.333 0.00 0.00 41.32 3.10
1346 1349 1.684983 GTATACCAGCCGCCAGTTCTA 59.315 52.381 0.00 0.00 0.00 2.10
1429 1432 0.039437 GTCGTGCTCCTCGTTTCTCA 60.039 55.000 0.00 0.00 0.00 3.27
1563 1569 3.244044 GCAGGAAAGTTTATGGGCAACAA 60.244 43.478 0.00 0.00 39.74 2.83
1567 1573 4.038642 GGAAAGTTTATGGGCAACAAGTCA 59.961 41.667 0.00 0.00 39.74 3.41
1749 1755 2.301870 AGGGCAATCGTTGAGTGAACTA 59.698 45.455 0.00 0.00 31.70 2.24
1996 2002 0.106918 ACCGACCCAGCAAGAAAACA 60.107 50.000 0.00 0.00 0.00 2.83
2080 2086 1.717032 CAGTCCATTCCGGGATAGGA 58.283 55.000 12.48 12.48 39.62 2.94
2153 2159 2.382770 ACCAGACCACTTGTGCCCA 61.383 57.895 0.00 0.00 0.00 5.36
2197 2203 3.767673 TGGAATGGCTCTCTTAGTTACGT 59.232 43.478 0.00 0.00 0.00 3.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 168 0.867753 GCGACGTGCTCCTACATCTG 60.868 60.000 0.00 0.0 41.73 2.90
388 389 1.780309 TCTGGGATGGTCAAAGTGGTT 59.220 47.619 0.00 0.0 0.00 3.67
752 753 0.105453 ATATGTGGAGAGAGCGGGGT 60.105 55.000 0.00 0.0 0.00 4.95
840 843 0.375454 CACAACGTCACTTTTCGCCA 59.625 50.000 0.00 0.0 0.00 5.69
1256 1259 2.903357 GCTTCATCGGGAGGCTCA 59.097 61.111 17.69 0.0 44.65 4.26
1563 1569 2.820059 TGAATCACTTCGTGCTGACT 57.180 45.000 0.00 0.0 33.86 3.41
1567 1573 3.603532 ACATGATGAATCACTTCGTGCT 58.396 40.909 0.00 0.0 40.83 4.40
1627 1633 6.224665 TCCATTTGTGGGAATTTGATGATC 57.775 37.500 0.00 0.0 0.00 2.92
1862 1868 2.476199 CCATCTCTCCTCAACTTCCCT 58.524 52.381 0.00 0.0 0.00 4.20
2080 2086 8.820831 ACTGCACATATTAGATTCTATTAGCCT 58.179 33.333 0.00 0.0 0.00 4.58
2153 2159 0.325296 TAGGGCGAGACAGAATGGGT 60.325 55.000 0.00 0.0 43.62 4.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.