Multiple sequence alignment - TraesCS3B01G109200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G109200 chr3B 100.000 2510 0 0 1 2510 75316185 75318694 0.000000e+00 4636.0
1 TraesCS3B01G109200 chrUn 99.642 2511 8 1 1 2510 39462705 39460195 0.000000e+00 4586.0
2 TraesCS3B01G109200 chrUn 86.902 397 49 2 1852 2246 84778688 84779083 2.290000e-120 442.0
3 TraesCS3B01G109200 chrUn 75.897 390 84 8 88 473 476057411 476057028 9.160000e-45 191.0
4 TraesCS3B01G109200 chr3A 89.004 1155 72 31 611 1752 60199840 60200952 0.000000e+00 1378.0
5 TraesCS3B01G109200 chr3A 91.045 402 32 3 1848 2246 416455313 416454913 7.900000e-150 540.0
6 TraesCS3B01G109200 chr3A 82.890 263 32 10 2256 2509 60201342 60201600 9.040000e-55 224.0
7 TraesCS3B01G109200 chr3A 77.258 299 63 5 177 473 719619924 719620219 1.190000e-38 171.0
8 TraesCS3B01G109200 chr3A 91.346 104 9 0 1745 1848 60201252 60201355 2.600000e-30 143.0
9 TraesCS3B01G109200 chr3D 88.907 613 39 12 1143 1752 47779465 47780051 0.000000e+00 728.0
10 TraesCS3B01G109200 chr3D 87.500 576 40 13 574 1143 47778759 47779308 9.790000e-179 636.0
11 TraesCS3B01G109200 chr3D 89.437 284 26 3 1 282 47775612 47775893 3.070000e-94 355.0
12 TraesCS3B01G109200 chr3D 90.254 236 19 3 334 569 47775886 47776117 3.140000e-79 305.0
13 TraesCS3B01G109200 chr3D 81.890 381 25 21 1468 1848 47780118 47780454 5.290000e-72 281.0
14 TraesCS3B01G109200 chr3D 79.143 350 67 5 81 426 24641458 24641111 1.160000e-58 237.0
15 TraesCS3B01G109200 chr7A 91.457 398 31 2 1851 2246 643639635 643640031 6.110000e-151 544.0
16 TraesCS3B01G109200 chr7A 84.524 84 11 1 82 163 598347858 598347941 5.750000e-12 82.4
17 TraesCS3B01G109200 chr2A 90.201 398 36 2 1851 2246 655757752 655758148 1.330000e-142 516.0
18 TraesCS3B01G109200 chr1D 89.447 398 39 2 1851 2246 22312801 22313197 1.340000e-137 499.0
19 TraesCS3B01G109200 chr1D 76.441 399 86 5 80 473 453461280 453461675 2.530000e-50 209.0
20 TraesCS3B01G109200 chr1D 78.467 274 55 4 204 475 432778426 432778697 2.570000e-40 176.0
21 TraesCS3B01G109200 chr1D 73.373 338 82 7 96 428 389805063 389805397 4.390000e-23 119.0
22 TraesCS3B01G109200 chr7B 86.683 398 50 2 1851 2246 73004989 73004593 2.960000e-119 438.0
23 TraesCS3B01G109200 chr5B 85.894 397 52 3 1851 2245 442951546 442951940 1.070000e-113 420.0
24 TraesCS3B01G109200 chr5D 84.514 381 54 4 1851 2228 449641815 449642193 3.050000e-99 372.0
25 TraesCS3B01G109200 chr6B 78.981 314 58 5 88 398 697974986 697974678 9.100000e-50 207.0
26 TraesCS3B01G109200 chr2B 74.065 401 91 9 82 473 24901543 24901147 4.320000e-33 152.0
27 TraesCS3B01G109200 chr7D 76.355 203 48 0 222 424 594989926 594990128 2.640000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G109200 chr3B 75316185 75318694 2509 False 4636.000000 4636 100.000000 1 2510 1 chr3B.!!$F1 2509
1 TraesCS3B01G109200 chrUn 39460195 39462705 2510 True 4586.000000 4586 99.642000 1 2510 1 chrUn.!!$R1 2509
2 TraesCS3B01G109200 chr3A 60199840 60201600 1760 False 581.666667 1378 87.746667 611 2509 3 chr3A.!!$F2 1898
3 TraesCS3B01G109200 chr3D 47775612 47780454 4842 False 461.000000 728 87.597600 1 1848 5 chr3D.!!$F1 1847

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
476 478 0.178068 AGACACACCTCCACACACAC 59.822 55.0 0.0 0.0 0.0 3.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1895 5072 0.10852 ACCAACGCCGTGTACCTATG 60.109 55.0 0.0 0.0 0.0 2.23 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
383 385 4.713553 TCTAACATGAAGGCACAAGAACA 58.286 39.130 0.00 0.0 0.00 3.18
476 478 0.178068 AGACACACCTCCACACACAC 59.822 55.000 0.00 0.0 0.00 3.82
2176 5353 2.354343 GCAAGAGCAAGGGCCTCT 59.646 61.111 6.46 0.0 42.56 3.69
2259 5436 2.032528 CAAACAGCCGCTGAGGGA 59.967 61.111 27.12 0.0 41.48 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
383 385 1.742761 TCCGGTCTTCGTTCGTCTAT 58.257 50.000 0.00 0.0 37.11 1.98
476 478 1.676006 GGACAAAATATGCGGAGGGTG 59.324 52.381 0.00 0.0 0.00 4.61
1895 5072 0.108520 ACCAACGCCGTGTACCTATG 60.109 55.000 0.00 0.0 0.00 2.23
2176 5353 0.893727 TGGAGACACTAGCGTGCAGA 60.894 55.000 0.00 0.0 45.10 4.26
2259 5436 5.473504 CGCTACCCTGCCTATTTATTTGATT 59.526 40.000 0.00 0.0 0.00 2.57
2481 5667 7.227711 TGAAGACGTCTTAAATTCCATGAACAA 59.772 33.333 29.79 0.0 36.11 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.