Multiple sequence alignment - TraesCS3B01G108500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G108500 chr3B 100.000 2774 0 0 1 2774 74293161 74295934 0.000000e+00 5123
1 TraesCS3B01G108500 chr3B 81.507 292 52 2 1079 1370 674063371 674063082 3.570000e-59 239
2 TraesCS3B01G108500 chr3A 98.380 2778 34 7 1 2774 59531169 59533939 0.000000e+00 4870
3 TraesCS3B01G108500 chr3A 82.566 304 49 4 1069 1370 647755512 647755211 5.890000e-67 265
4 TraesCS3B01G108500 chr3D 98.199 2777 41 7 1 2774 47492518 47495288 0.000000e+00 4843
5 TraesCS3B01G108500 chr3D 82.566 304 49 4 1069 1370 511726696 511726395 5.890000e-67 265
6 TraesCS3B01G108500 chr1B 83.673 294 46 2 1077 1370 475470110 475469819 2.720000e-70 276
7 TraesCS3B01G108500 chr1A 83.333 294 47 2 1077 1370 453523511 453523220 1.270000e-68 270
8 TraesCS3B01G108500 chr4B 85.547 256 35 2 1077 1331 77651298 77651552 1.640000e-67 267
9 TraesCS3B01G108500 chr4D 84.766 256 37 2 1077 1331 52763828 52764082 3.550000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G108500 chr3B 74293161 74295934 2773 False 5123 5123 100.000 1 2774 1 chr3B.!!$F1 2773
1 TraesCS3B01G108500 chr3A 59531169 59533939 2770 False 4870 4870 98.380 1 2774 1 chr3A.!!$F1 2773
2 TraesCS3B01G108500 chr3D 47492518 47495288 2770 False 4843 4843 98.199 1 2774 1 chr3D.!!$F1 2773

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
151 152 1.134175 GCTGCCAGAGAGACAGTAGTC 59.866 57.143 0.0 0.0 45.31 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1914 1919 1.410517 GCATCCATCGGTCTTGAGAGA 59.589 52.381 0.0 0.0 0.0 3.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 1.134175 GCTGCCAGAGAGACAGTAGTC 59.866 57.143 0.00 0.00 45.31 2.59
233 234 3.349022 AGGAGACAAGAACTAGTCCTCG 58.651 50.000 0.00 0.00 35.38 4.63
275 276 5.264395 TCCATTCAAAATTTCTCTCCTCCC 58.736 41.667 0.00 0.00 0.00 4.30
276 277 5.015603 TCCATTCAAAATTTCTCTCCTCCCT 59.984 40.000 0.00 0.00 0.00 4.20
324 326 2.357517 AAGAGACGGGCTGCAACG 60.358 61.111 13.20 13.20 0.00 4.10
414 416 2.005960 CTCTCCGCTAGTTGACCCCG 62.006 65.000 0.00 0.00 0.00 5.73
666 668 3.853671 GGCTCTACATGCATTTGTTTTCG 59.146 43.478 0.00 0.00 0.00 3.46
758 761 4.734695 GCCTCCTTGTTGTGAAGTTGAAAG 60.735 45.833 0.00 0.00 0.00 2.62
795 799 9.547279 AGATACAACTATTTTCCCCATTTCTTT 57.453 29.630 0.00 0.00 0.00 2.52
940 945 6.128117 CGGAAGAAACGAATATTTTTCTGGGA 60.128 38.462 13.41 0.00 40.44 4.37
1008 1013 2.829914 TCGCTGGCAATGGCATCC 60.830 61.111 10.64 3.76 43.71 3.51
1395 1400 3.141488 CTCCTCCGCTACGCCTGT 61.141 66.667 0.00 0.00 0.00 4.00
1913 1918 4.040952 GTGCATGTGGATTACCTCTCCTAT 59.959 45.833 0.00 0.00 37.04 2.57
1914 1919 4.660303 TGCATGTGGATTACCTCTCCTATT 59.340 41.667 0.00 0.00 37.04 1.73
1934 1939 1.410517 TCTCTCAAGACCGATGGATGC 59.589 52.381 0.00 0.00 0.00 3.91
2685 2693 8.119845 TGTGCATTGTACATGTATTTATTCGAC 58.880 33.333 9.18 0.00 0.00 4.20
2714 2722 3.539604 AGATTTCTCTTTCGCTGGGATG 58.460 45.455 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
233 234 3.748568 TGGAAAAACAGGCAAACAAACAC 59.251 39.130 0.00 0.0 0.00 3.32
275 276 3.117589 GCTTCACAGCATGGCAAAG 57.882 52.632 0.00 0.0 46.49 2.77
414 416 2.103941 CCCTGCTCATCCTTACCTCTTC 59.896 54.545 0.00 0.0 0.00 2.87
940 945 7.014615 AGAGCTGTCAAATGGTTAGTCATTTTT 59.985 33.333 0.00 0.0 42.63 1.94
1913 1918 2.159043 GCATCCATCGGTCTTGAGAGAA 60.159 50.000 0.00 0.0 32.66 2.87
1914 1919 1.410517 GCATCCATCGGTCTTGAGAGA 59.589 52.381 0.00 0.0 0.00 3.10
1934 1939 2.096069 CCAAAGCGCATATCATTCTCCG 60.096 50.000 11.47 0.0 0.00 4.63
2714 2722 1.070134 GCCCAAAGAAAACCCCAGTTC 59.930 52.381 0.00 0.0 34.19 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.