Multiple sequence alignment - TraesCS3B01G106300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G106300 chr3B 100.000 3245 0 0 1 3245 71908051 71911295 0.000000e+00 5993
1 TraesCS3B01G106300 chr3B 91.298 2965 223 34 300 3245 295072644 295069696 0.000000e+00 4013
2 TraesCS3B01G106300 chr3B 90.371 2887 247 29 372 3245 645181510 645184378 0.000000e+00 3762
3 TraesCS3B01G106300 chr3B 87.442 3026 308 53 249 3245 74831254 74828272 0.000000e+00 3417
4 TraesCS3B01G106300 chr3B 85.949 1217 124 37 2065 3245 284885577 284884372 0.000000e+00 1256
5 TraesCS3B01G106300 chr3B 89.796 147 7 6 3100 3245 321733783 321733644 7.150000e-42 182
6 TraesCS3B01G106300 chr3B 88.435 147 9 5 3100 3245 393195360 393195499 1.550000e-38 171
7 TraesCS3B01G106300 chr5B 96.519 2844 87 11 408 3245 370324912 370322075 0.000000e+00 4693
8 TraesCS3B01G106300 chr1B 98.944 2273 20 3 973 3245 414867141 414869409 0.000000e+00 4061
9 TraesCS3B01G106300 chr1B 89.422 1834 147 24 12 1839 416160166 416158374 0.000000e+00 2268
10 TraesCS3B01G106300 chr1B 96.323 979 14 3 1 977 414861329 414862287 0.000000e+00 1589
11 TraesCS3B01G106300 chr1B 98.022 556 9 1 1 554 414870901 414871456 0.000000e+00 965
12 TraesCS3B01G106300 chr1B 97.487 557 11 2 1 554 166341056 166340500 0.000000e+00 948
13 TraesCS3B01G106300 chr1B 88.321 548 43 12 12 554 416146473 416145942 3.530000e-179 638
14 TraesCS3B01G106300 chr2B 90.606 2938 233 39 327 3245 115619519 115616606 0.000000e+00 3856
15 TraesCS3B01G106300 chr2B 90.402 2938 240 38 327 3245 115615074 115612160 0.000000e+00 3825
16 TraesCS3B01G106300 chr2B 90.364 2937 242 37 327 3245 115610662 115607749 0.000000e+00 3818
17 TraesCS3B01G106300 chr1D 87.021 3028 341 42 247 3245 143123692 143120688 0.000000e+00 3367
18 TraesCS3B01G106300 chr7B 89.877 978 68 20 2294 3245 242316324 242317296 0.000000e+00 1229
19 TraesCS3B01G106300 chr7B 89.458 977 72 21 2295 3245 242304789 242303818 0.000000e+00 1205
20 TraesCS3B01G106300 chr7B 89.041 146 8 5 3100 3244 368858040 368858178 1.200000e-39 174
21 TraesCS3B01G106300 chr2A 83.994 1262 145 40 2025 3245 266907017 266905772 0.000000e+00 1158
22 TraesCS3B01G106300 chr2A 81.548 504 56 22 56 552 300409208 300409681 6.570000e-102 381
23 TraesCS3B01G106300 chr6B 95.046 545 24 2 12 554 144618094 144618637 0.000000e+00 854
24 TraesCS3B01G106300 chr3A 88.270 503 53 5 56 554 299483212 299483712 5.990000e-167 597


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G106300 chr3B 71908051 71911295 3244 False 5993 5993 100.000000 1 3245 1 chr3B.!!$F1 3244
1 TraesCS3B01G106300 chr3B 295069696 295072644 2948 True 4013 4013 91.298000 300 3245 1 chr3B.!!$R3 2945
2 TraesCS3B01G106300 chr3B 645181510 645184378 2868 False 3762 3762 90.371000 372 3245 1 chr3B.!!$F3 2873
3 TraesCS3B01G106300 chr3B 74828272 74831254 2982 True 3417 3417 87.442000 249 3245 1 chr3B.!!$R1 2996
4 TraesCS3B01G106300 chr3B 284884372 284885577 1205 True 1256 1256 85.949000 2065 3245 1 chr3B.!!$R2 1180
5 TraesCS3B01G106300 chr5B 370322075 370324912 2837 True 4693 4693 96.519000 408 3245 1 chr5B.!!$R1 2837
6 TraesCS3B01G106300 chr1B 414867141 414871456 4315 False 2513 4061 98.483000 1 3245 2 chr1B.!!$F2 3244
7 TraesCS3B01G106300 chr1B 416158374 416160166 1792 True 2268 2268 89.422000 12 1839 1 chr1B.!!$R3 1827
8 TraesCS3B01G106300 chr1B 414861329 414862287 958 False 1589 1589 96.323000 1 977 1 chr1B.!!$F1 976
9 TraesCS3B01G106300 chr1B 166340500 166341056 556 True 948 948 97.487000 1 554 1 chr1B.!!$R1 553
10 TraesCS3B01G106300 chr1B 416145942 416146473 531 True 638 638 88.321000 12 554 1 chr1B.!!$R2 542
11 TraesCS3B01G106300 chr2B 115607749 115619519 11770 True 3833 3856 90.457333 327 3245 3 chr2B.!!$R1 2918
12 TraesCS3B01G106300 chr1D 143120688 143123692 3004 True 3367 3367 87.021000 247 3245 1 chr1D.!!$R1 2998
13 TraesCS3B01G106300 chr7B 242316324 242317296 972 False 1229 1229 89.877000 2294 3245 1 chr7B.!!$F1 951
14 TraesCS3B01G106300 chr7B 242303818 242304789 971 True 1205 1205 89.458000 2295 3245 1 chr7B.!!$R1 950
15 TraesCS3B01G106300 chr2A 266905772 266907017 1245 True 1158 1158 83.994000 2025 3245 1 chr2A.!!$R1 1220
16 TraesCS3B01G106300 chr6B 144618094 144618637 543 False 854 854 95.046000 12 554 1 chr6B.!!$F1 542
17 TraesCS3B01G106300 chr3A 299483212 299483712 500 False 597 597 88.270000 56 554 1 chr3A.!!$F1 498

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
529 547 1.197492 CCGTAGTTTGGGGCGTAAAAC 59.803 52.381 1.42 1.42 36.69 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2300 6777 0.612229 CTGCAGCTCTTCTCCCTTGA 59.388 55.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
529 547 1.197492 CCGTAGTTTGGGGCGTAAAAC 59.803 52.381 1.42 1.42 36.69 2.43
787 809 3.004171 AGCAACACTACAAACAACACGA 58.996 40.909 0.00 0.00 0.00 4.35
901 923 7.124147 GCTCTTATGATCCTTATTCTAGAGGCT 59.876 40.741 0.00 0.00 32.93 4.58
940 962 5.363580 CCTACCTGCCATATTTGTGGATTTT 59.636 40.000 0.00 0.00 42.02 1.82
1311 5779 2.778299 GTGCCCACACAAGATGAGTTA 58.222 47.619 0.00 0.00 46.61 2.24
1431 5899 5.662674 TTAAGAGTGGAAAGGAGCTAGTC 57.337 43.478 0.00 0.00 0.00 2.59
1689 6157 8.954834 AAGACTCATCATCTATTACTCCTGAT 57.045 34.615 0.00 0.00 0.00 2.90
2460 6941 2.497273 GCCATGTCTTAAATGTTGCCCT 59.503 45.455 0.00 0.00 0.00 5.19
2710 7198 4.264253 CCATTGAGAGCAATCACCTAACA 58.736 43.478 0.00 0.00 42.66 2.41
3027 11950 1.341679 TGGTCGAGCCAGGTGTATACT 60.342 52.381 12.85 0.00 43.61 2.12
3041 11964 6.015350 CAGGTGTATACTATGTTCTCGGGATT 60.015 42.308 4.17 0.00 0.00 3.01
3202 12165 7.816031 ACAATCATCATTTGAACTTGTTGATCC 59.184 33.333 0.00 0.00 35.14 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
452 468 1.414158 ATGCTCGGCTAAAGCTAGGA 58.586 50.000 1.39 2.15 40.50 2.94
529 547 3.815809 TCAATTGAAAGTATAGCGGGGG 58.184 45.455 5.45 0.00 0.00 5.40
787 809 8.974060 TTACCTATCAGTTCTTGAACACTTTT 57.026 30.769 14.80 0.00 39.77 2.27
901 923 4.040461 GCAGGTAGGAGCAACATAAGGATA 59.960 45.833 0.00 0.00 0.00 2.59
1311 5779 4.465660 AGTGTGAGCTTGTCTATGTCATCT 59.534 41.667 0.00 0.00 0.00 2.90
1431 5899 7.316640 TCTTCTCAATCTTCCTTACTTCTTCG 58.683 38.462 0.00 0.00 0.00 3.79
1689 6157 3.475566 ACAGCAGCTTCTTGTACTTCA 57.524 42.857 0.00 0.00 0.00 3.02
2300 6777 0.612229 CTGCAGCTCTTCTCCCTTGA 59.388 55.000 0.00 0.00 0.00 3.02
2460 6941 8.673711 GCACCATATGTCAAGTAAAATTCAGTA 58.326 33.333 1.24 0.00 0.00 2.74
2710 7198 6.656693 GGAACATAGCATGCTAATCCATAGTT 59.343 38.462 32.11 24.80 33.66 2.24
3027 11950 2.193127 ACCACCAATCCCGAGAACATA 58.807 47.619 0.00 0.00 0.00 2.29
3041 11964 3.454447 CTCACCATAGGAACATACCACCA 59.546 47.826 0.00 0.00 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.