Multiple sequence alignment - TraesCS3B01G085500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G085500 chr3B 100.000 2785 0 0 1 2785 53954093 53956877 0.000000e+00 5144.0
1 TraesCS3B01G085500 chr6A 99.070 2796 13 2 1 2785 559265277 559268070 0.000000e+00 5007.0
2 TraesCS3B01G085500 chr1B 98.752 2483 30 1 1 2482 457534858 457537340 0.000000e+00 4412.0
3 TraesCS3B01G085500 chr1B 98.697 307 4 0 2479 2785 457537596 457537902 1.890000e-151 545.0
4 TraesCS3B01G085500 chr2D 86.893 1503 146 38 716 2198 128387352 128388823 0.000000e+00 1637.0
5 TraesCS3B01G085500 chr2D 83.487 866 101 32 647 1496 128374192 128375031 0.000000e+00 769.0
6 TraesCS3B01G085500 chr2D 95.082 183 9 0 1 183 128373961 128374143 3.510000e-74 289.0
7 TraesCS3B01G085500 chr2D 94.828 58 3 0 1 58 492523415 492523358 1.060000e-14 91.6
8 TraesCS3B01G085500 chr5A 88.757 1343 105 28 994 2321 633026623 633025312 0.000000e+00 1602.0
9 TraesCS3B01G085500 chr5A 90.256 821 66 8 171 977 633027849 633027029 0.000000e+00 1061.0
10 TraesCS3B01G085500 chr5A 83.000 100 11 4 2629 2726 632875094 632874999 4.940000e-13 86.1
11 TraesCS3B01G085500 chr5B 88.832 1182 85 29 994 2144 635609024 635607859 0.000000e+00 1408.0
12 TraesCS3B01G085500 chr5B 90.194 826 62 9 171 977 635610237 635609412 0.000000e+00 1059.0
13 TraesCS3B01G085500 chr5B 86.006 343 25 14 2238 2574 635607757 635607432 2.050000e-91 346.0
14 TraesCS3B01G085500 chr5B 94.186 172 7 1 2187 2355 635607856 635607685 2.750000e-65 259.0
15 TraesCS3B01G085500 chr5B 91.975 162 10 3 2625 2785 635607425 635607266 1.000000e-54 224.0
16 TraesCS3B01G085500 chr5B 87.000 100 10 3 2629 2726 635378041 635377943 2.930000e-20 110.0
17 TraesCS3B01G085500 chr3D 88.966 1160 96 22 1055 2198 411871447 411872590 0.000000e+00 1404.0
18 TraesCS3B01G085500 chr3D 89.918 972 69 19 1244 2198 352943150 352944109 0.000000e+00 1225.0
19 TraesCS3B01G085500 chr3D 89.583 816 71 8 171 977 208632701 208631891 0.000000e+00 1024.0
20 TraesCS3B01G085500 chr3D 89.820 334 30 4 647 977 411871049 411871381 2.560000e-115 425.0
21 TraesCS3B01G085500 chr3D 95.082 183 9 0 1 183 352930518 352930700 3.510000e-74 289.0
22 TraesCS3B01G085500 chr3D 95.082 183 9 0 1 183 411870818 411871000 3.510000e-74 289.0
23 TraesCS3B01G085500 chr5D 89.648 995 83 13 1 977 505545395 505544403 0.000000e+00 1249.0
24 TraesCS3B01G085500 chr5D 91.791 804 51 5 1346 2149 505543702 505542914 0.000000e+00 1105.0
25 TraesCS3B01G085500 chr5D 93.827 324 16 2 980 1299 505544021 505543698 4.170000e-133 484.0
26 TraesCS3B01G085500 chr5D 91.765 340 22 3 2447 2785 505542669 505542335 4.200000e-128 468.0
27 TraesCS3B01G085500 chr5D 88.288 111 11 2 2212 2321 505542879 505542770 6.260000e-27 132.0
28 TraesCS3B01G085500 chr5D 85.000 100 12 3 2629 2726 505369288 505369190 6.350000e-17 99.0
29 TraesCS3B01G085500 chr2A 93.750 624 36 2 1575 2198 610064804 610064184 0.000000e+00 933.0
30 TraesCS3B01G085500 chr2A 94.410 161 8 1 24 183 610065355 610065195 2.140000e-61 246.0
31 TraesCS3B01G085500 chr7A 82.397 943 114 42 647 1570 606180585 606181494 0.000000e+00 774.0
32 TraesCS3B01G085500 chr7A 94.022 184 10 1 1 183 606180353 606180536 7.600000e-71 278.0
33 TraesCS3B01G085500 chrUn 100.000 415 0 0 56 470 477304833 477304419 0.000000e+00 767.0
34 TraesCS3B01G085500 chrUn 81.897 116 18 1 171 283 41895987 41896102 8.210000e-16 95.3
35 TraesCS3B01G085500 chr6B 93.243 370 21 2 229 594 707241615 707241246 2.440000e-150 542.0
36 TraesCS3B01G085500 chr4A 81.897 116 18 1 171 283 16147123 16147238 8.210000e-16 95.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G085500 chr3B 53954093 53956877 2784 False 5144.0 5144 100.000000 1 2785 1 chr3B.!!$F1 2784
1 TraesCS3B01G085500 chr6A 559265277 559268070 2793 False 5007.0 5007 99.070000 1 2785 1 chr6A.!!$F1 2784
2 TraesCS3B01G085500 chr1B 457534858 457537902 3044 False 2478.5 4412 98.724500 1 2785 2 chr1B.!!$F1 2784
3 TraesCS3B01G085500 chr2D 128387352 128388823 1471 False 1637.0 1637 86.893000 716 2198 1 chr2D.!!$F1 1482
4 TraesCS3B01G085500 chr2D 128373961 128375031 1070 False 529.0 769 89.284500 1 1496 2 chr2D.!!$F2 1495
5 TraesCS3B01G085500 chr5A 633025312 633027849 2537 True 1331.5 1602 89.506500 171 2321 2 chr5A.!!$R2 2150
6 TraesCS3B01G085500 chr5B 635607266 635610237 2971 True 659.2 1408 90.238600 171 2785 5 chr5B.!!$R2 2614
7 TraesCS3B01G085500 chr3D 352943150 352944109 959 False 1225.0 1225 89.918000 1244 2198 1 chr3D.!!$F2 954
8 TraesCS3B01G085500 chr3D 208631891 208632701 810 True 1024.0 1024 89.583000 171 977 1 chr3D.!!$R1 806
9 TraesCS3B01G085500 chr3D 411870818 411872590 1772 False 706.0 1404 91.289333 1 2198 3 chr3D.!!$F3 2197
10 TraesCS3B01G085500 chr5D 505542335 505545395 3060 True 687.6 1249 91.063800 1 2785 5 chr5D.!!$R2 2784
11 TraesCS3B01G085500 chr2A 610064184 610065355 1171 True 589.5 933 94.080000 24 2198 2 chr2A.!!$R1 2174
12 TraesCS3B01G085500 chr7A 606180353 606181494 1141 False 526.0 774 88.209500 1 1570 2 chr7A.!!$F1 1569

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
731 778 1.702182 TTCTGCAGCCAACCATTTCA 58.298 45.0 9.47 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2404 2951 3.377172 GGTTAGTTGTAATCGCCATGCTT 59.623 43.478 0.0 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
470 506 4.178540 TGCTCGTTGGTTACTTACATAGC 58.821 43.478 0.00 0.0 0.00 2.97
731 778 1.702182 TTCTGCAGCCAACCATTTCA 58.298 45.000 9.47 0.0 0.00 2.69
851 903 9.669353 GTGGATGATTGCTACATTTTATAGTTG 57.331 33.333 0.00 0.0 0.00 3.16
990 1431 3.063510 TGGAAGCAGAGAATCCTTGTG 57.936 47.619 0.00 0.0 33.66 3.33
991 1432 2.373169 TGGAAGCAGAGAATCCTTGTGT 59.627 45.455 0.00 0.0 33.66 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
470 506 5.144692 ACAGGTTCTCCATCGATGATATG 57.855 43.478 26.86 15.59 35.89 1.78
990 1431 1.441738 GAATTTGCATGGCCCAACAC 58.558 50.000 0.00 0.00 0.00 3.32
991 1432 0.324285 GGAATTTGCATGGCCCAACA 59.676 50.000 0.00 0.00 0.00 3.33
2404 2951 3.377172 GGTTAGTTGTAATCGCCATGCTT 59.623 43.478 0.00 0.00 0.00 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.