Multiple sequence alignment - TraesCS3B01G078400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G078400 chr3B 100.000 2471 0 0 1 2471 49567444 49569914 0.000000e+00 4564.0
1 TraesCS3B01G078400 chr3B 98.540 2465 26 7 9 2471 49465591 49468047 0.000000e+00 4344.0
2 TraesCS3B01G078400 chr3B 97.738 2476 41 11 3 2471 49627844 49630311 0.000000e+00 4248.0
3 TraesCS3B01G078400 chr3B 98.143 1400 19 3 3 1395 49515372 49516771 0.000000e+00 2435.0
4 TraesCS3B01G078400 chr3B 98.349 1090 12 4 1383 2471 49518836 49519920 0.000000e+00 1908.0
5 TraesCS3B01G078400 chr3B 97.086 961 20 6 1513 2471 49427373 49428327 0.000000e+00 1613.0
6 TraesCS3B01G078400 chr3B 96.659 449 12 3 3 448 49668354 49668802 0.000000e+00 743.0
7 TraesCS3B01G078400 chr3B 91.688 397 30 3 1096 1489 49426778 49427174 4.650000e-152 547.0
8 TraesCS3B01G078400 chr3B 84.775 289 23 13 757 1029 49426383 49426666 1.130000e-68 270.0
9 TraesCS3B01G078400 chr3B 87.097 124 10 3 1028 1148 49426755 49426875 4.290000e-28 135.0
10 TraesCS3B01G078400 chr3D 88.889 630 36 13 1177 1773 28991664 28992292 0.000000e+00 745.0
11 TraesCS3B01G078400 chr3D 91.743 109 6 1 1028 1133 28991593 28991701 5.510000e-32 148.0
12 TraesCS3B01G078400 chr2D 84.627 670 59 22 6 655 59651819 59652464 5.800000e-176 627.0
13 TraesCS3B01G078400 chr2D 73.051 731 132 53 38 723 605881301 605880591 5.390000e-47 198.0
14 TraesCS3B01G078400 chr1A 82.195 747 72 31 6 723 153914043 153913329 9.850000e-164 586.0
15 TraesCS3B01G078400 chr3A 96.825 315 10 0 1181 1495 38371608 38371922 6.050000e-146 527.0
16 TraesCS3B01G078400 chr3A 89.542 153 9 4 1503 1649 38371960 38372111 1.170000e-43 187.0
17 TraesCS3B01G078400 chr3A 93.578 109 4 1 1028 1133 38371533 38371641 2.540000e-35 159.0
18 TraesCS3B01G078400 chr3A 75.836 269 34 21 181 444 677837798 677837556 9.340000e-20 108.0
19 TraesCS3B01G078400 chr1B 78.182 275 42 16 180 444 55456632 55456366 2.540000e-35 159.0
20 TraesCS3B01G078400 chr1B 80.556 108 12 7 342 444 44026623 44026520 9.480000e-10 75.0
21 TraesCS3B01G078400 chr7B 84.921 126 8 7 1028 1143 586743191 586743315 1.550000e-22 117.0
22 TraesCS3B01G078400 chr7B 87.179 78 10 0 779 856 652946863 652946786 3.380000e-14 89.8
23 TraesCS3B01G078400 chr7B 94.737 38 2 0 818 855 695826836 695826873 2.650000e-05 60.2
24 TraesCS3B01G078400 chr7B 94.737 38 2 0 818 855 695848535 695848572 2.650000e-05 60.2
25 TraesCS3B01G078400 chr7D 85.185 81 7 3 776 856 584773380 584773305 7.330000e-11 78.7
26 TraesCS3B01G078400 chrUn 93.478 46 3 0 1028 1073 316289185 316289230 4.410000e-08 69.4
27 TraesCS3B01G078400 chrUn 94.737 38 2 0 818 855 311162513 311162550 2.650000e-05 60.2
28 TraesCS3B01G078400 chr6A 93.478 46 3 0 1028 1073 585006897 585006942 4.410000e-08 69.4
29 TraesCS3B01G078400 chr5B 94.737 38 2 0 819 856 646672912 646672875 2.650000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G078400 chr3B 49567444 49569914 2470 False 4564.00 4564 100.0000 1 2471 1 chr3B.!!$F2 2470
1 TraesCS3B01G078400 chr3B 49465591 49468047 2456 False 4344.00 4344 98.5400 9 2471 1 chr3B.!!$F1 2462
2 TraesCS3B01G078400 chr3B 49627844 49630311 2467 False 4248.00 4248 97.7380 3 2471 1 chr3B.!!$F3 2468
3 TraesCS3B01G078400 chr3B 49515372 49519920 4548 False 2171.50 2435 98.2460 3 2471 2 chr3B.!!$F6 2468
4 TraesCS3B01G078400 chr3B 49426383 49428327 1944 False 641.25 1613 90.1615 757 2471 4 chr3B.!!$F5 1714
5 TraesCS3B01G078400 chr3D 28991593 28992292 699 False 446.50 745 90.3160 1028 1773 2 chr3D.!!$F1 745
6 TraesCS3B01G078400 chr2D 59651819 59652464 645 False 627.00 627 84.6270 6 655 1 chr2D.!!$F1 649
7 TraesCS3B01G078400 chr1A 153913329 153914043 714 True 586.00 586 82.1950 6 723 1 chr1A.!!$R1 717
8 TraesCS3B01G078400 chr3A 38371533 38372111 578 False 291.00 527 93.3150 1028 1649 3 chr3A.!!$F1 621

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
737 798 3.648545 GGAGCTCTTACCAACAGGGATAT 59.351 47.826 14.64 0.0 41.15 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2144 4621 1.088306 AGAGCTCTCCGACAAGTACG 58.912 55.0 11.45 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 537 6.707440 TTTCTTTTTGTCATCTAGCCAACA 57.293 33.333 0.00 0.0 0.00 3.33
507 540 3.788227 TTTGTCATCTAGCCAACAGGT 57.212 42.857 0.00 0.0 0.00 4.00
737 798 3.648545 GGAGCTCTTACCAACAGGGATAT 59.351 47.826 14.64 0.0 41.15 1.63
1682 4152 4.020573 TGAAATAAGTTCTTCAGCCGAGGA 60.021 41.667 0.00 0.0 37.13 3.71
2035 4512 8.478877 AGAAACTAGAGAATACCGATGAAATGT 58.521 33.333 0.00 0.0 0.00 2.71
2154 4631 1.226323 CGGAGGAGCGTACTTGTCG 60.226 63.158 0.00 0.0 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.647424 AAGTTCGTTCAATTTGAGGCAA 57.353 36.364 0.00 0.0 0.00 4.52
1 2 4.647424 AAAGTTCGTTCAATTTGAGGCA 57.353 36.364 0.00 0.0 0.00 4.75
618 678 2.837291 CGCTAGCTGGCTCCTCCT 60.837 66.667 20.56 0.0 35.26 3.69
1682 4152 2.359900 GGCATTTCTCATGGACGAACT 58.640 47.619 0.00 0.0 0.00 3.01
1822 4295 6.379703 TGTTCCATTTTGTCTTTCCTTCTCAA 59.620 34.615 0.00 0.0 0.00 3.02
1987 4464 9.898152 TTTCTTTTTATGTTCCCTTTTTGATGT 57.102 25.926 0.00 0.0 0.00 3.06
2010 4487 8.543774 CACATTTCATCGGTATTCTCTAGTTTC 58.456 37.037 0.00 0.0 0.00 2.78
2144 4621 1.088306 AGAGCTCTCCGACAAGTACG 58.912 55.000 11.45 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.