Multiple sequence alignment - TraesCS3B01G078300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G078300 chr3B 100.000 2384 0 0 1 2384 49465669 49468052 0.000000e+00 4403.0
1 TraesCS3B01G078300 chr3B 98.495 2392 26 7 1 2384 49567530 49569919 0.000000e+00 4209.0
2 TraesCS3B01G078300 chr3B 97.827 2393 39 8 1 2384 49627928 49630316 0.000000e+00 4119.0
3 TraesCS3B01G078300 chr3B 97.720 1316 22 4 1 1308 49515456 49516771 0.000000e+00 2257.0
4 TraesCS3B01G078300 chr3B 99.267 1091 5 2 1296 2384 49518836 49519925 0.000000e+00 1967.0
5 TraesCS3B01G078300 chr3B 98.231 961 14 2 1426 2384 49427373 49428332 0.000000e+00 1677.0
6 TraesCS3B01G078300 chr3B 96.712 365 9 2 1 362 49668438 49668802 2.620000e-169 604.0
7 TraesCS3B01G078300 chr3B 91.688 397 30 3 1009 1402 49426778 49427174 4.480000e-152 547.0
8 TraesCS3B01G078300 chr3B 84.429 289 24 13 670 942 49426383 49426666 5.050000e-67 265.0
9 TraesCS3B01G078300 chr3B 87.097 124 10 3 941 1061 49426755 49426875 4.130000e-28 135.0
10 TraesCS3B01G078300 chr3B 85.542 83 1 3 1413 1485 49427216 49427297 2.540000e-10 76.8
11 TraesCS3B01G078300 chr3D 88.889 630 34 14 1090 1684 28991664 28992292 0.000000e+00 743.0
12 TraesCS3B01G078300 chr3D 91.743 109 6 1 941 1046 28991593 28991701 5.310000e-32 148.0
13 TraesCS3B01G078300 chr3A 96.825 315 10 0 1094 1408 38371608 38371922 5.840000e-146 527.0
14 TraesCS3B01G078300 chr3A 90.196 153 8 4 1416 1562 38371960 38372111 2.420000e-45 193.0
15 TraesCS3B01G078300 chr3A 93.578 109 4 1 941 1046 38371533 38371641 2.450000e-35 159.0
16 TraesCS3B01G078300 chr3A 74.349 269 38 18 95 358 677837798 677837556 4.220000e-13 86.1
17 TraesCS3B01G078300 chr1A 82.051 663 62 27 1 636 153913961 153913329 1.630000e-141 512.0
18 TraesCS3B01G078300 chr1B 77.737 274 45 14 94 358 55456632 55456366 1.140000e-33 154.0
19 TraesCS3B01G078300 chr1B 82.243 107 11 6 257 358 44026623 44026520 4.220000e-13 86.1
20 TraesCS3B01G078300 chr2D 72.059 680 128 50 1 636 605881252 605880591 1.910000e-31 147.0
21 TraesCS3B01G078300 chr7B 84.921 126 8 7 941 1056 586743191 586743315 1.500000e-22 117.0
22 TraesCS3B01G078300 chr7B 87.179 78 10 0 692 769 652946863 652946786 3.260000e-14 89.8
23 TraesCS3B01G078300 chr7B 94.737 38 2 0 731 768 695826836 695826873 2.560000e-05 60.2
24 TraesCS3B01G078300 chr7B 94.737 38 2 0 731 768 695848535 695848572 2.560000e-05 60.2
25 TraesCS3B01G078300 chr7D 85.185 81 7 3 689 769 584773380 584773305 7.070000e-11 78.7
26 TraesCS3B01G078300 chrUn 93.478 46 3 0 941 986 316289185 316289230 4.250000e-08 69.4
27 TraesCS3B01G078300 chrUn 94.737 38 2 0 731 768 311162513 311162550 2.560000e-05 60.2
28 TraesCS3B01G078300 chr6A 93.478 46 3 0 941 986 585006897 585006942 4.250000e-08 69.4
29 TraesCS3B01G078300 chr5B 94.737 38 2 0 732 769 646672912 646672875 2.560000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G078300 chr3B 49465669 49468052 2383 False 4403.00 4403 100.0000 1 2384 1 chr3B.!!$F1 2383
1 TraesCS3B01G078300 chr3B 49567530 49569919 2389 False 4209.00 4209 98.4950 1 2384 1 chr3B.!!$F2 2383
2 TraesCS3B01G078300 chr3B 49627928 49630316 2388 False 4119.00 4119 97.8270 1 2384 1 chr3B.!!$F3 2383
3 TraesCS3B01G078300 chr3B 49515456 49519925 4469 False 2112.00 2257 98.4935 1 2384 2 chr3B.!!$F6 2383
4 TraesCS3B01G078300 chr3B 49426383 49428332 1949 False 540.16 1677 89.3974 670 2384 5 chr3B.!!$F5 1714
5 TraesCS3B01G078300 chr3D 28991593 28992292 699 False 445.50 743 90.3160 941 1684 2 chr3D.!!$F1 743
6 TraesCS3B01G078300 chr3A 38371533 38372111 578 False 293.00 527 93.5330 941 1562 3 chr3A.!!$F1 621
7 TraesCS3B01G078300 chr1A 153913329 153913961 632 True 512.00 512 82.0510 1 636 1 chr1A.!!$R1 635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
131 132 8.10280 TGATGATCTTTTTCCATATTCGATGG 57.897 34.615 0.00 0.00 40.48 3.51 F
462 471 8.79283 ATGAGTACATACTGTTGCAATTTAGT 57.207 30.769 0.59 10.51 36.50 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1129 1279 0.258774 ACCAACTTGACCTGCACCTT 59.741 50.0 0.0 0.0 0.0 3.50 R
2145 4563 4.795795 CGACATAAAAACACAAACACTGCA 59.204 37.5 0.0 0.0 0.0 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 8.102800 TGATGATCTTTTTCCATATTCGATGG 57.897 34.615 0.00 0.00 40.48 3.51
462 471 8.792830 ATGAGTACATACTGTTGCAATTTAGT 57.207 30.769 0.59 10.51 36.50 2.24
1129 1279 0.401738 CACCTTCAAGGCCAAGGAGA 59.598 55.000 23.62 3.19 42.94 3.71
1130 1280 1.149101 ACCTTCAAGGCCAAGGAGAA 58.851 50.000 23.62 10.40 42.94 2.87
1728 4137 8.362639 TGGAAGAAAAAGAAATTGAGGATGAAG 58.637 33.333 0.00 0.00 0.00 3.02
2145 4563 1.640917 CCGGTACATATGGGCCTAGT 58.359 55.000 4.53 0.22 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
305 311 7.136119 TCGTCGAATTTGCTAAAAAGTTCATT 58.864 30.769 0.0 0.0 0.0 2.57
1129 1279 0.258774 ACCAACTTGACCTGCACCTT 59.741 50.000 0.0 0.0 0.0 3.50
1130 1280 0.466189 CACCAACTTGACCTGCACCT 60.466 55.000 0.0 0.0 0.0 4.00
2145 4563 4.795795 CGACATAAAAACACAAACACTGCA 59.204 37.500 0.0 0.0 0.0 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.