Multiple sequence alignment - TraesCS3B01G075700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G075700 chr3B 100.000 2871 0 0 1 2871 46614775 46611905 0.000000e+00 5302
1 TraesCS3B01G075700 chr3B 99.405 2858 13 1 1 2854 46470639 46467782 0.000000e+00 5180
2 TraesCS3B01G075700 chr7D 81.877 1385 187 36 744 2096 497046755 497045403 0.000000e+00 1109
3 TraesCS3B01G075700 chr7B 86.435 833 106 6 1307 2138 525026140 525025314 0.000000e+00 905
4 TraesCS3B01G075700 chr7B 77.309 498 87 12 744 1230 525026976 525026494 1.310000e-68 270
5 TraesCS3B01G075700 chr7A 85.819 818 93 16 1295 2096 562303549 562302739 0.000000e+00 846
6 TraesCS3B01G075700 chr7A 84.375 128 14 4 2712 2834 274168765 274168639 1.400000e-23 121
7 TraesCS3B01G075700 chr5A 87.587 572 68 3 1305 1875 40720215 40720784 0.000000e+00 660
8 TraesCS3B01G075700 chr5D 87.413 572 69 3 1305 1875 51686400 51686969 0.000000e+00 654
9 TraesCS3B01G075700 chr5B 87.238 572 70 3 1305 1875 54702616 54703185 0.000000e+00 649
10 TraesCS3B01G075700 chr2A 88.800 125 11 2 2712 2834 749828741 749828864 1.780000e-32 150
11 TraesCS3B01G075700 chr2B 87.200 125 12 3 2712 2834 756066220 756066342 3.860000e-29 139
12 TraesCS3B01G075700 chr4A 87.179 117 13 1 2712 2826 737360368 737360484 6.450000e-27 132
13 TraesCS3B01G075700 chr4A 83.594 128 15 4 2712 2834 590307372 590307246 6.500000e-22 115
14 TraesCS3B01G075700 chr1A 83.448 145 21 3 2712 2853 9102945 9102801 6.450000e-27 132
15 TraesCS3B01G075700 chr3A 84.733 131 15 4 2712 2839 645084137 645084009 3.000000e-25 126
16 TraesCS3B01G075700 chr6B 82.576 132 19 2 2707 2834 388647686 388647817 2.340000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G075700 chr3B 46611905 46614775 2870 True 5302.0 5302 100.000 1 2871 1 chr3B.!!$R2 2870
1 TraesCS3B01G075700 chr3B 46467782 46470639 2857 True 5180.0 5180 99.405 1 2854 1 chr3B.!!$R1 2853
2 TraesCS3B01G075700 chr7D 497045403 497046755 1352 True 1109.0 1109 81.877 744 2096 1 chr7D.!!$R1 1352
3 TraesCS3B01G075700 chr7B 525025314 525026976 1662 True 587.5 905 81.872 744 2138 2 chr7B.!!$R1 1394
4 TraesCS3B01G075700 chr7A 562302739 562303549 810 True 846.0 846 85.819 1295 2096 1 chr7A.!!$R2 801
5 TraesCS3B01G075700 chr5A 40720215 40720784 569 False 660.0 660 87.587 1305 1875 1 chr5A.!!$F1 570
6 TraesCS3B01G075700 chr5D 51686400 51686969 569 False 654.0 654 87.413 1305 1875 1 chr5D.!!$F1 570
7 TraesCS3B01G075700 chr5B 54702616 54703185 569 False 649.0 649 87.238 1305 1875 1 chr5B.!!$F1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
884 891 9.355215 CGTACTTGACTTGTTCTATTAACTCAT 57.645 33.333 0.0 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2576 2885 1.941812 GGCTGATATTTGCCGACGG 59.058 57.895 10.29 10.29 39.71 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
854 859 9.955102 ACTTTAATCGGTTAATAAGTTCCTCTT 57.045 29.630 0.86 0.00 39.89 2.85
884 891 9.355215 CGTACTTGACTTGTTCTATTAACTCAT 57.645 33.333 0.00 0.00 0.00 2.90
1010 1017 3.771216 AGAAACTCACAATGGCATCCTT 58.229 40.909 0.00 0.00 0.00 3.36
2059 2368 7.277917 GCGGTGTTGTTATTTCATTGTTTAAC 58.722 34.615 0.00 0.00 0.00 2.01
2282 2591 4.907946 CGCAACAGAGTTGTGCTG 57.092 55.556 10.06 0.00 37.67 4.41
2450 2759 3.911894 AGGGCTGGTAACTTAACTGGTTA 59.088 43.478 0.00 0.00 37.61 2.85
2625 2934 0.909623 ACCAACCTAAGTCGATGGGG 59.090 55.000 4.14 0.38 35.44 4.96
2862 3175 5.023551 CAAACTCTTGCAACTAGTAGCAC 57.976 43.478 9.52 0.00 41.05 4.40
2863 3176 4.336889 AACTCTTGCAACTAGTAGCACA 57.663 40.909 9.52 0.00 41.05 4.57
2864 3177 3.919216 ACTCTTGCAACTAGTAGCACAG 58.081 45.455 7.73 0.00 41.05 3.66
2865 3178 3.322254 ACTCTTGCAACTAGTAGCACAGT 59.678 43.478 7.73 0.00 41.05 3.55
2866 3179 3.653344 TCTTGCAACTAGTAGCACAGTG 58.347 45.455 0.00 0.00 41.05 3.66
2867 3180 3.320826 TCTTGCAACTAGTAGCACAGTGA 59.679 43.478 4.15 0.00 41.05 3.41
2868 3181 3.961480 TGCAACTAGTAGCACAGTGAT 57.039 42.857 4.15 0.00 35.51 3.06
2869 3182 5.185056 TCTTGCAACTAGTAGCACAGTGATA 59.815 40.000 4.15 0.00 41.05 2.15
2870 3183 5.598416 TGCAACTAGTAGCACAGTGATAT 57.402 39.130 4.15 0.00 35.51 1.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
854 859 9.350357 GTTAATAGAACAAGTCAAGTACGATCA 57.650 33.333 0.00 0.00 0.00 2.92
884 891 1.494721 AGGAAGCCAGGAACTTTCACA 59.505 47.619 0.00 0.00 34.60 3.58
1010 1017 3.729108 AGAAGATGGAATGAGGAGGTGA 58.271 45.455 0.00 0.00 0.00 4.02
2059 2368 3.777478 GAGCACATCCACATTCCATTTG 58.223 45.455 0.00 0.00 0.00 2.32
2450 2759 5.711506 TGTACTGCATTTCCAATTGTGAGAT 59.288 36.000 4.43 0.00 0.00 2.75
2576 2885 1.941812 GGCTGATATTTGCCGACGG 59.058 57.895 10.29 10.29 39.71 4.79
2625 2934 2.989840 CGATCTATCTTTGCCGATGGAC 59.010 50.000 0.00 0.00 34.38 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.