Multiple sequence alignment - TraesCS3B01G075600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G075600 chr3B 100.000 2871 0 0 1 2871 46470639 46467769 0.000000e+00 5302
1 TraesCS3B01G075600 chr3B 99.405 2858 13 1 1 2858 46614775 46611922 0.000000e+00 5180
2 TraesCS3B01G075600 chr7D 82.094 1385 184 37 744 2096 497046755 497045403 0.000000e+00 1125
3 TraesCS3B01G075600 chr7D 86.127 173 16 6 2705 2871 528567905 528567735 2.270000e-41 180
4 TraesCS3B01G075600 chr7B 86.435 833 106 6 1307 2138 525026140 525025314 0.000000e+00 905
5 TraesCS3B01G075600 chr7B 77.510 498 86 13 744 1230 525026976 525026494 2.820000e-70 276
6 TraesCS3B01G075600 chr7A 85.819 818 93 16 1295 2096 562303549 562302739 0.000000e+00 846
7 TraesCS3B01G075600 chr5A 82.620 794 101 23 1305 2092 40720215 40720977 0.000000e+00 667
8 TraesCS3B01G075600 chr5D 87.587 572 68 3 1305 1875 51686400 51686969 0.000000e+00 660
9 TraesCS3B01G075600 chr5D 85.465 172 19 4 2705 2871 7984012 7983842 1.060000e-39 174
10 TraesCS3B01G075600 chr5D 81.765 170 28 2 2704 2871 453836976 453836808 3.860000e-29 139
11 TraesCS3B01G075600 chr5B 87.413 572 69 3 1305 1875 54702616 54703185 0.000000e+00 654
12 TraesCS3B01G075600 chr5B 83.529 170 24 4 2704 2871 554529015 554528848 3.830000e-34 156
13 TraesCS3B01G075600 chr4B 87.324 142 16 1 2699 2838 101311847 101311988 8.230000e-36 161
14 TraesCS3B01G075600 chr2D 88.636 132 13 1 2701 2830 593361648 593361517 2.960000e-35 159
15 TraesCS3B01G075600 chr2A 88.060 134 13 2 2707 2838 749828732 749828864 3.830000e-34 156
16 TraesCS3B01G075600 chr2B 87.313 134 13 3 2707 2838 756066211 756066342 1.780000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G075600 chr3B 46467769 46470639 2870 True 5302.0 5302 100.0000 1 2871 1 chr3B.!!$R1 2870
1 TraesCS3B01G075600 chr3B 46611922 46614775 2853 True 5180.0 5180 99.4050 1 2858 1 chr3B.!!$R2 2857
2 TraesCS3B01G075600 chr7D 497045403 497046755 1352 True 1125.0 1125 82.0940 744 2096 1 chr7D.!!$R1 1352
3 TraesCS3B01G075600 chr7B 525025314 525026976 1662 True 590.5 905 81.9725 744 2138 2 chr7B.!!$R1 1394
4 TraesCS3B01G075600 chr7A 562302739 562303549 810 True 846.0 846 85.8190 1295 2096 1 chr7A.!!$R1 801
5 TraesCS3B01G075600 chr5A 40720215 40720977 762 False 667.0 667 82.6200 1305 2092 1 chr5A.!!$F1 787
6 TraesCS3B01G075600 chr5D 51686400 51686969 569 False 660.0 660 87.5870 1305 1875 1 chr5D.!!$F1 570
7 TraesCS3B01G075600 chr5B 54702616 54703185 569 False 654.0 654 87.4130 1305 1875 1 chr5B.!!$F1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1135 1144 0.104304 GTCCCCTGGTATGCACTACG 59.896 60.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2712 3021 2.299297 GACGATCCCCTATACTTGTGGG 59.701 54.545 0.0 0.0 40.59 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1135 1144 0.104304 GTCCCCTGGTATGCACTACG 59.896 60.000 0.00 0.00 0.00 3.51
2450 2759 2.817844 GGGCTGGTAACTTAACTGGTTG 59.182 50.000 0.00 0.00 37.61 3.77
2625 2934 1.553248 CACCAACCTAAGTCGATGGGA 59.447 52.381 4.14 0.00 35.44 4.37
2711 3020 0.244721 CTGTCCGTCAGCACTGATGA 59.755 55.000 19.18 9.48 46.68 2.92
2712 3021 0.038251 TGTCCGTCAGCACTGATGAC 60.038 55.000 19.18 16.06 46.68 3.06
2713 3022 0.737715 GTCCGTCAGCACTGATGACC 60.738 60.000 19.31 4.48 44.78 4.02
2714 3023 1.448540 CCGTCAGCACTGATGACCC 60.449 63.158 19.31 0.00 44.78 4.46
2870 3179 9.599322 CAAACTCTTGCAACAATTTACTAGTAG 57.401 33.333 2.23 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1135 1144 7.439356 ACTCACTCATACACATGCATACAATAC 59.561 37.037 0.00 0.00 31.73 1.89
2450 2759 4.510038 ACTGCATTTCCAATTGTGAGAC 57.490 40.909 4.43 0.00 0.00 3.36
2576 2885 2.986311 GGCTGATATTTGCCGACGA 58.014 52.632 0.00 0.00 39.71 4.20
2625 2934 3.854666 CGATCTATCTTTGCCGATGGAT 58.145 45.455 6.39 6.39 42.18 3.41
2711 3020 2.326428 CGATCCCCTATACTTGTGGGT 58.674 52.381 0.00 0.00 39.31 4.51
2712 3021 2.299297 GACGATCCCCTATACTTGTGGG 59.701 54.545 0.00 0.00 40.59 4.61
2713 3022 3.005897 CAGACGATCCCCTATACTTGTGG 59.994 52.174 0.00 0.00 0.00 4.17
2714 3023 3.637229 ACAGACGATCCCCTATACTTGTG 59.363 47.826 0.00 0.00 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.