Multiple sequence alignment - TraesCS3B01G074900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G074900 chr3B 100.000 2483 0 0 1 2483 46008975 46006493 0.000000e+00 4586.0
1 TraesCS3B01G074900 chr3B 98.913 2484 26 1 1 2483 45862698 45860215 0.000000e+00 4436.0
2 TraesCS3B01G074900 chr3B 98.833 2486 26 2 1 2483 45958987 45956502 0.000000e+00 4427.0
3 TraesCS3B01G074900 chr3B 97.756 1025 19 3 1462 2483 45877263 45876240 0.000000e+00 1762.0
4 TraesCS3B01G074900 chr3B 97.463 1025 22 3 1462 2483 46023875 46022852 0.000000e+00 1746.0
5 TraesCS3B01G074900 chr3B 98.473 786 12 0 1698 2483 45769602 45768817 0.000000e+00 1386.0
6 TraesCS3B01G074900 chr3B 98.473 786 12 0 1698 2483 45839744 45838959 0.000000e+00 1386.0
7 TraesCS3B01G074900 chr3B 98.473 786 12 0 1698 2483 45934831 45934046 0.000000e+00 1386.0
8 TraesCS3B01G074900 chr3B 97.964 786 15 1 1698 2483 45984800 45984016 0.000000e+00 1362.0
9 TraesCS3B01G074900 chr3B 97.293 665 13 3 1 663 45877450 45876789 0.000000e+00 1123.0
10 TraesCS3B01G074900 chr3B 97.293 665 13 3 1 663 46024062 46023401 0.000000e+00 1123.0
11 TraesCS3B01G074900 chr3B 95.607 478 15 3 1462 1934 45862511 45862035 0.000000e+00 761.0
12 TraesCS3B01G074900 chr3B 95.397 478 18 2 187 663 45957525 45957051 0.000000e+00 758.0
13 TraesCS3B01G074900 chr3B 95.188 478 17 3 187 663 46007514 46007042 0.000000e+00 750.0
14 TraesCS3B01G074900 chr3B 94.979 478 18 3 187 663 45861236 45860764 0.000000e+00 745.0
15 TraesCS3B01G074900 chr3B 97.267 439 10 2 2 439 45943638 45943201 0.000000e+00 743.0
16 TraesCS3B01G074900 chr3B 93.763 481 22 4 187 664 60125857 60126332 0.000000e+00 715.0
17 TraesCS3B01G074900 chr3B 96.667 240 5 1 424 663 45934831 45934595 1.790000e-106 396.0
18 TraesCS3B01G074900 chr3B 100.000 29 0 0 2455 2483 45754159 45754131 1.000000e-03 54.7
19 TraesCS3B01G074900 chr4B 89.177 924 89 7 699 1618 315694470 315693554 0.000000e+00 1142.0
20 TraesCS3B01G074900 chr3D 88.424 933 97 10 687 1618 223449837 223450759 0.000000e+00 1114.0
21 TraesCS3B01G074900 chr3D 92.035 452 23 5 1938 2376 27526555 27526104 7.540000e-175 623.0
22 TraesCS3B01G074900 chr3D 95.745 188 6 2 1 187 27526740 27526554 4.010000e-78 302.0
23 TraesCS3B01G074900 chr3D 95.722 187 7 1 1 186 27630576 27630390 1.440000e-77 300.0
24 TraesCS3B01G074900 chr5A 87.691 918 101 7 700 1614 1812433 1811525 0.000000e+00 1059.0
25 TraesCS3B01G074900 chr1D 88.826 877 79 13 752 1614 69474754 69473883 0.000000e+00 1059.0
26 TraesCS3B01G074900 chr1D 88.617 817 88 5 653 1466 453423701 453424515 0.000000e+00 989.0
27 TraesCS3B01G074900 chr1D 91.473 129 7 2 595 723 351857631 351857755 9.130000e-40 174.0
28 TraesCS3B01G074900 chr5B 90.839 775 71 0 693 1467 130932265 130931491 0.000000e+00 1038.0
29 TraesCS3B01G074900 chr7B 88.249 868 97 5 752 1618 386694197 386693334 0.000000e+00 1033.0
30 TraesCS3B01G074900 chr1B 88.218 348 33 7 567 913 253093385 253093725 2.300000e-110 409.0
31 TraesCS3B01G074900 chr3A 94.652 187 9 1 1 186 37629617 37629431 3.120000e-74 289.0
32 TraesCS3B01G074900 chr6B 93.023 86 6 0 2369 2454 96970754 96970839 2.590000e-25 126.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G074900 chr3B 46006493 46008975 2482 True 2668.000000 4586 97.594000 1 2483 2 chr3B.!!$R10 2482
1 TraesCS3B01G074900 chr3B 45956502 45958987 2485 True 2592.500000 4427 97.115000 1 2483 2 chr3B.!!$R9 2482
2 TraesCS3B01G074900 chr3B 45860215 45862698 2483 True 1980.666667 4436 96.499667 1 2483 3 chr3B.!!$R6 2482
3 TraesCS3B01G074900 chr3B 45876240 45877450 1210 True 1442.500000 1762 97.524500 1 2483 2 chr3B.!!$R7 2482
4 TraesCS3B01G074900 chr3B 46022852 46024062 1210 True 1434.500000 1746 97.378000 1 2483 2 chr3B.!!$R11 2482
5 TraesCS3B01G074900 chr3B 45768817 45769602 785 True 1386.000000 1386 98.473000 1698 2483 1 chr3B.!!$R2 785
6 TraesCS3B01G074900 chr3B 45838959 45839744 785 True 1386.000000 1386 98.473000 1698 2483 1 chr3B.!!$R3 785
7 TraesCS3B01G074900 chr3B 45984016 45984800 784 True 1362.000000 1362 97.964000 1698 2483 1 chr3B.!!$R5 785
8 TraesCS3B01G074900 chr3B 45934046 45934831 785 True 891.000000 1386 97.570000 424 2483 2 chr3B.!!$R8 2059
9 TraesCS3B01G074900 chr4B 315693554 315694470 916 True 1142.000000 1142 89.177000 699 1618 1 chr4B.!!$R1 919
10 TraesCS3B01G074900 chr3D 223449837 223450759 922 False 1114.000000 1114 88.424000 687 1618 1 chr3D.!!$F1 931
11 TraesCS3B01G074900 chr3D 27526104 27526740 636 True 462.500000 623 93.890000 1 2376 2 chr3D.!!$R2 2375
12 TraesCS3B01G074900 chr5A 1811525 1812433 908 True 1059.000000 1059 87.691000 700 1614 1 chr5A.!!$R1 914
13 TraesCS3B01G074900 chr1D 69473883 69474754 871 True 1059.000000 1059 88.826000 752 1614 1 chr1D.!!$R1 862
14 TraesCS3B01G074900 chr1D 453423701 453424515 814 False 989.000000 989 88.617000 653 1466 1 chr1D.!!$F2 813
15 TraesCS3B01G074900 chr5B 130931491 130932265 774 True 1038.000000 1038 90.839000 693 1467 1 chr5B.!!$R1 774
16 TraesCS3B01G074900 chr7B 386693334 386694197 863 True 1033.000000 1033 88.249000 752 1618 1 chr7B.!!$R1 866

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
474 477 0.108329 CACTACTGGCCGGGTAACAG 60.108 60.0 18.0 7.15 38.19 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1624 1643 1.603456 ATTGGTTGTGATGTGCGTCA 58.397 45.0 0.0 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
111 112 7.598493 ACATGTGTGTTTTACAAGATTTATGGC 59.402 33.333 0.0 0.00 41.89 4.40
468 471 2.046314 CAACCACTACTGGCCGGG 60.046 66.667 18.0 5.11 42.08 5.73
474 477 0.108329 CACTACTGGCCGGGTAACAG 60.108 60.000 18.0 7.15 38.19 3.16
668 671 5.126707 CCGTGGTTTACTCCTAACATACTCT 59.873 44.000 0.0 0.00 0.00 3.24
669 672 6.350780 CCGTGGTTTACTCCTAACATACTCTT 60.351 42.308 0.0 0.00 0.00 2.85
1988 2009 8.519799 AGTCTTTTGTGACTTAAAAATGGAGA 57.480 30.769 0.0 0.00 44.01 3.71
2213 2241 0.033699 AGCAATGGGAAGGAGAAGGC 60.034 55.000 0.0 0.00 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
668 671 3.561313 GGAGGCAAGTCATGGTTTAGGAA 60.561 47.826 0.00 0.00 0.00 3.36
669 672 2.026262 GGAGGCAAGTCATGGTTTAGGA 60.026 50.000 0.00 0.00 0.00 2.94
821 827 4.856607 GTCGCCGGCGGAGAAGAG 62.857 72.222 44.95 18.23 40.25 2.85
1472 1483 1.706305 GGAGAGGTAGCTAGAGGGCTA 59.294 57.143 0.00 0.00 42.97 3.93
1515 1531 6.595682 TCTCTCTTGTCCATTGTTCTTCTTT 58.404 36.000 0.00 0.00 0.00 2.52
1624 1643 1.603456 ATTGGTTGTGATGTGCGTCA 58.397 45.000 0.00 0.00 0.00 4.35
1988 2009 7.618512 TCTGGTTAGGAACTTACTACTTAGCAT 59.381 37.037 0.00 0.00 41.75 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.