Multiple sequence alignment - TraesCS3B01G073200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G073200 chr3B 100.000 4060 0 0 1 4060 44046408 44042349 0.000000e+00 7498.0
1 TraesCS3B01G073200 chr3B 99.828 4060 7 0 1 4060 43940928 43936869 0.000000e+00 7459.0
2 TraesCS3B01G073200 chr3B 95.328 685 25 2 3382 4060 675670867 675671550 0.000000e+00 1081.0
3 TraesCS3B01G073200 chr3B 94.461 686 31 2 3382 4060 716319320 716318635 0.000000e+00 1050.0
4 TraesCS3B01G073200 chr3B 89.583 432 18 7 988 1394 607415427 607414998 1.290000e-144 523.0
5 TraesCS3B01G073200 chr3B 81.104 471 68 6 1 452 452826094 452826562 1.390000e-94 357.0
6 TraesCS3B01G073200 chr3B 78.696 460 68 13 1417 1869 801045157 801044721 3.090000e-71 279.0
7 TraesCS3B01G073200 chr3B 91.892 185 13 2 1243 1426 801052848 801052665 1.450000e-64 257.0
8 TraesCS3B01G073200 chr3B 86.538 156 10 6 1501 1656 607414939 607414795 1.170000e-35 161.0
9 TraesCS3B01G073200 chr3B 87.342 79 9 1 2097 2174 43852549 43852471 5.590000e-14 89.8
10 TraesCS3B01G073200 chr3D 91.910 2571 129 32 871 3383 26306300 26303751 0.000000e+00 3522.0
11 TraesCS3B01G073200 chr3D 82.902 193 29 2 3180 3368 26228083 26228275 1.940000e-38 171.0
12 TraesCS3B01G073200 chr3D 83.750 160 22 3 3226 3383 26285165 26285008 9.090000e-32 148.0
13 TraesCS3B01G073200 chr3D 83.125 160 27 0 3218 3377 26219441 26219600 3.270000e-31 147.0
14 TraesCS3B01G073200 chr3D 91.667 84 7 0 2080 2163 26268306 26268223 2.560000e-22 117.0
15 TraesCS3B01G073200 chr3D 90.123 81 6 2 2097 2176 26285748 26285669 2.000000e-18 104.0
16 TraesCS3B01G073200 chr3D 86.076 79 10 1 2097 2174 26294313 26294235 2.600000e-12 84.2
17 TraesCS3B01G073200 chr1B 97.226 685 13 1 3382 4060 1304432 1305116 0.000000e+00 1155.0
18 TraesCS3B01G073200 chr1B 94.453 685 32 1 3382 4060 449714551 449713867 0.000000e+00 1050.0
19 TraesCS3B01G073200 chr1B 90.000 80 7 1 644 722 431454186 431454107 7.180000e-18 102.0
20 TraesCS3B01G073200 chr7B 96.496 685 17 2 3382 4060 689892655 689893338 0.000000e+00 1125.0
21 TraesCS3B01G073200 chr7B 96.058 685 14 5 3382 4060 725167793 725167116 0.000000e+00 1103.0
22 TraesCS3B01G073200 chr7B 95.620 685 24 1 3382 4060 176228268 176228952 0.000000e+00 1094.0
23 TraesCS3B01G073200 chr6B 95.620 685 24 1 3382 4060 28178008 28177324 0.000000e+00 1094.0
24 TraesCS3B01G073200 chr6B 86.593 455 56 5 1 453 354364071 354363620 7.840000e-137 497.0
25 TraesCS3B01G073200 chr6B 88.506 87 7 3 642 727 255998802 255998886 7.180000e-18 102.0
26 TraesCS3B01G073200 chr3A 81.220 1033 103 47 875 1869 36305276 36304297 0.000000e+00 749.0
27 TraesCS3B01G073200 chr3A 93.269 208 10 2 3180 3383 36303240 36303033 1.830000e-78 303.0
28 TraesCS3B01G073200 chr3A 92.715 151 10 1 2095 2245 36304135 36303986 2.460000e-52 217.0
29 TraesCS3B01G073200 chr3A 83.654 208 30 2 3180 3383 36249578 36249371 4.140000e-45 193.0
30 TraesCS3B01G073200 chr3A 85.714 168 20 3 3218 3383 36286661 36286496 1.500000e-39 174.0
31 TraesCS3B01G073200 chr2A 86.444 450 54 6 2 449 42334597 42335041 1.700000e-133 486.0
32 TraesCS3B01G073200 chr5B 85.043 468 53 6 1 452 645890077 645890543 1.030000e-125 460.0
33 TraesCS3B01G073200 chr5B 83.974 468 59 8 1 452 219032758 219032291 6.230000e-118 435.0
34 TraesCS3B01G073200 chr5B 91.463 82 5 2 647 727 79417843 79417763 1.190000e-20 111.0
35 TraesCS3B01G073200 chr5B 90.244 82 6 2 647 727 449342604 449342524 5.550000e-19 106.0
36 TraesCS3B01G073200 chr5D 84.567 473 51 12 1 453 324637842 324638312 2.230000e-122 449.0
37 TraesCS3B01G073200 chr5D 82.265 468 64 11 1 451 253654671 253655136 1.770000e-103 387.0
38 TraesCS3B01G073200 chr1D 84.648 469 53 10 1 452 309001185 309001651 2.230000e-122 449.0
39 TraesCS3B01G073200 chr2B 83.940 467 60 5 1 452 26390452 26390918 2.240000e-117 433.0
40 TraesCS3B01G073200 chr2B 82.942 469 60 7 1 452 748363419 748362954 4.890000e-109 405.0
41 TraesCS3B01G073200 chr7D 84.813 428 44 12 1 411 618194286 618194709 1.050000e-110 411.0
42 TraesCS3B01G073200 chr7D 82.974 464 60 7 1 448 534319302 534319762 6.320000e-108 401.0
43 TraesCS3B01G073200 chr7D 90.805 87 6 2 642 727 264342070 264341985 9.220000e-22 115.0
44 TraesCS3B01G073200 chr7D 90.123 81 4 2 648 727 116602480 116602403 7.180000e-18 102.0
45 TraesCS3B01G073200 chr4B 83.047 466 60 6 3 452 479050980 479050518 4.890000e-109 405.0
46 TraesCS3B01G073200 chr4B 82.906 468 62 5 1 452 530311596 530311131 4.890000e-109 405.0
47 TraesCS3B01G073200 chr4D 89.655 87 7 2 642 727 1344266 1344351 4.290000e-20 110.0
48 TraesCS3B01G073200 chrUn 77.000 200 37 7 2634 2830 245871684 245871877 5.550000e-19 106.0
49 TraesCS3B01G073200 chrUn 77.000 200 37 7 2634 2830 260287235 260287042 5.550000e-19 106.0
50 TraesCS3B01G073200 chr4A 90.244 82 6 2 647 727 661700030 661699950 5.550000e-19 106.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G073200 chr3B 44042349 44046408 4059 True 7498 7498 100.0000 1 4060 1 chr3B.!!$R3 4059
1 TraesCS3B01G073200 chr3B 43936869 43940928 4059 True 7459 7459 99.8280 1 4060 1 chr3B.!!$R2 4059
2 TraesCS3B01G073200 chr3B 675670867 675671550 683 False 1081 1081 95.3280 3382 4060 1 chr3B.!!$F2 678
3 TraesCS3B01G073200 chr3B 716318635 716319320 685 True 1050 1050 94.4610 3382 4060 1 chr3B.!!$R4 678
4 TraesCS3B01G073200 chr3B 607414795 607415427 632 True 342 523 88.0605 988 1656 2 chr3B.!!$R7 668
5 TraesCS3B01G073200 chr3D 26303751 26306300 2549 True 3522 3522 91.9100 871 3383 1 chr3D.!!$R3 2512
6 TraesCS3B01G073200 chr1B 1304432 1305116 684 False 1155 1155 97.2260 3382 4060 1 chr1B.!!$F1 678
7 TraesCS3B01G073200 chr1B 449713867 449714551 684 True 1050 1050 94.4530 3382 4060 1 chr1B.!!$R2 678
8 TraesCS3B01G073200 chr7B 689892655 689893338 683 False 1125 1125 96.4960 3382 4060 1 chr7B.!!$F2 678
9 TraesCS3B01G073200 chr7B 725167116 725167793 677 True 1103 1103 96.0580 3382 4060 1 chr7B.!!$R1 678
10 TraesCS3B01G073200 chr7B 176228268 176228952 684 False 1094 1094 95.6200 3382 4060 1 chr7B.!!$F1 678
11 TraesCS3B01G073200 chr6B 28177324 28178008 684 True 1094 1094 95.6200 3382 4060 1 chr6B.!!$R1 678
12 TraesCS3B01G073200 chr3A 36303033 36305276 2243 True 423 749 89.0680 875 3383 3 chr3A.!!$R3 2508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
45 46 3.680786 CGTGTCGGTGAGCTGGGA 61.681 66.667 0.0 0.0 0.0 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4018 4178 2.776526 AAGCCACCCACCTGACCA 60.777 61.111 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 3.680786 CGTGTCGGTGAGCTGGGA 61.681 66.667 0.0 0.0 0.0 4.37
217 218 9.031537 TCATAGCCTTTGAATCCTCGTATAATA 57.968 33.333 0.0 0.0 0.0 0.98
372 373 8.621286 GTCCAAATGATAAACGGTGAAGATAAT 58.379 33.333 0.0 0.0 0.0 1.28
4018 4178 0.550147 TAGGAAGGGCAAAGGAGGCT 60.550 55.000 0.0 0.0 0.0 4.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
372 373 4.036262 GCGGTTGACCAATAAGATTATGCA 59.964 41.667 0.51 0.0 35.14 3.96
4018 4178 2.776526 AAGCCACCCACCTGACCA 60.777 61.111 0.00 0.0 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.