Multiple sequence alignment - TraesCS3B01G073000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G073000 chr3B 100.000 3693 0 0 1 3693 43940905 43937213 0.000000e+00 6820.0
1 TraesCS3B01G073000 chr3B 99.892 3693 4 0 1 3693 44046385 44042693 0.000000e+00 6798.0
2 TraesCS3B01G073000 chr3B 95.522 335 14 1 3359 3693 675670867 675671200 5.430000e-148 534.0
3 TraesCS3B01G073000 chr3B 89.583 432 18 7 965 1371 607415427 607414998 1.180000e-144 523.0
4 TraesCS3B01G073000 chr3B 83.333 444 55 5 2 429 544076050 544076490 3.460000e-105 392.0
5 TraesCS3B01G073000 chr3B 78.696 460 68 13 1394 1846 801045157 801044721 2.810000e-71 279.0
6 TraesCS3B01G073000 chr3B 91.892 185 13 2 1220 1403 801052848 801052665 1.320000e-64 257.0
7 TraesCS3B01G073000 chr3B 86.538 156 10 6 1478 1633 607414939 607414795 1.060000e-35 161.0
8 TraesCS3B01G073000 chr3B 87.342 79 9 1 2074 2151 43852549 43852471 5.080000e-14 89.8
9 TraesCS3B01G073000 chr3D 91.910 2571 129 32 848 3360 26306300 26303751 0.000000e+00 3522.0
10 TraesCS3B01G073000 chr3D 82.902 193 29 2 3157 3345 26228083 26228275 1.760000e-38 171.0
11 TraesCS3B01G073000 chr3D 83.750 160 22 3 3203 3360 26285165 26285008 8.260000e-32 148.0
12 TraesCS3B01G073000 chr3D 83.125 160 27 0 3195 3354 26219441 26219600 2.970000e-31 147.0
13 TraesCS3B01G073000 chr3D 91.667 84 7 0 2057 2140 26268306 26268223 2.330000e-22 117.0
14 TraesCS3B01G073000 chr3D 90.123 81 6 2 2074 2153 26285748 26285669 1.810000e-18 104.0
15 TraesCS3B01G073000 chr3D 86.076 79 10 1 2074 2151 26294313 26294235 2.360000e-12 84.2
16 TraesCS3B01G073000 chr3A 81.220 1033 103 47 852 1846 36305276 36304297 0.000000e+00 749.0
17 TraesCS3B01G073000 chr3A 81.655 447 64 7 1 430 562882074 562882519 4.540000e-94 355.0
18 TraesCS3B01G073000 chr3A 93.269 208 10 2 3157 3360 36303240 36303033 1.670000e-78 303.0
19 TraesCS3B01G073000 chr3A 92.715 151 10 1 2072 2222 36304135 36303986 2.230000e-52 217.0
20 TraesCS3B01G073000 chr3A 83.654 208 30 2 3157 3360 36249578 36249371 3.760000e-45 193.0
21 TraesCS3B01G073000 chr3A 85.714 168 20 3 3195 3360 36286661 36286496 1.360000e-39 174.0
22 TraesCS3B01G073000 chr1B 98.209 335 6 0 3359 3693 1304432 1304766 1.480000e-163 586.0
23 TraesCS3B01G073000 chr1B 95.224 335 16 0 3359 3693 813151 812817 7.020000e-147 531.0
24 TraesCS3B01G073000 chr1B 95.224 335 16 0 3359 3693 449714551 449714217 7.020000e-147 531.0
25 TraesCS3B01G073000 chr1B 90.000 80 7 1 621 699 431454186 431454107 6.520000e-18 102.0
26 TraesCS3B01G073000 chr7B 97.313 335 8 1 3359 3693 689892655 689892988 5.350000e-158 568.0
27 TraesCS3B01G073000 chr7B 97.015 335 10 0 3359 3693 176228268 176228602 6.920000e-157 564.0
28 TraesCS3B01G073000 chr7B 97.015 335 6 2 3359 3693 725167793 725167463 8.960000e-156 560.0
29 TraesCS3B01G073000 chr6B 95.522 335 15 0 3359 3693 28178008 28177674 1.510000e-148 536.0
30 TraesCS3B01G073000 chr6B 86.574 432 53 5 1 430 354364048 354363620 4.320000e-129 472.0
31 TraesCS3B01G073000 chr6B 88.506 87 7 3 619 704 255998802 255998886 6.520000e-18 102.0
32 TraesCS3B01G073000 chr7D 86.261 444 41 6 1 426 421451856 421452297 7.220000e-127 464.0
33 TraesCS3B01G073000 chr7D 84.691 405 41 12 1 388 618194309 618194709 5.790000e-103 385.0
34 TraesCS3B01G073000 chr7D 90.805 87 6 2 619 704 264342070 264341985 8.380000e-22 115.0
35 TraesCS3B01G073000 chr7D 90.123 81 4 2 625 704 116602480 116602403 6.520000e-18 102.0
36 TraesCS3B01G073000 chr2A 86.215 428 52 6 1 426 42334619 42335041 1.210000e-124 457.0
37 TraesCS3B01G073000 chr5D 84.889 450 46 11 1 430 324637865 324638312 5.660000e-118 435.0
38 TraesCS3B01G073000 chr5B 84.944 445 50 6 1 429 645890100 645890543 5.660000e-118 435.0
39 TraesCS3B01G073000 chr5B 91.463 82 5 2 624 704 79417843 79417763 1.080000e-20 111.0
40 TraesCS3B01G073000 chr5B 90.244 82 6 2 624 704 449342604 449342524 5.040000e-19 106.0
41 TraesCS3B01G073000 chr2B 84.753 446 48 9 1 429 20564053 20563611 2.640000e-116 429.0
42 TraesCS3B01G073000 chr2B 83.973 443 56 5 2 429 26356727 26357169 9.550000e-111 411.0
43 TraesCS3B01G073000 chr2B 83.036 448 58 8 3 433 377668101 377667655 1.240000e-104 390.0
44 TraesCS3B01G073000 chr5A 84.494 445 52 4 1 429 590998324 590998767 1.230000e-114 424.0
45 TraesCS3B01G073000 chr4D 83.820 445 55 8 1 429 43862929 43863372 1.230000e-109 407.0
46 TraesCS3B01G073000 chr4D 89.655 87 7 2 619 704 1344266 1344351 3.900000e-20 110.0
47 TraesCS3B01G073000 chr1D 83.296 449 50 17 1 429 380306237 380306680 1.240000e-104 390.0
48 TraesCS3B01G073000 chr1A 80.625 160 24 3 196 355 251671400 251671248 2.330000e-22 117.0
49 TraesCS3B01G073000 chrUn 77.000 200 37 7 2611 2807 245871684 245871877 5.040000e-19 106.0
50 TraesCS3B01G073000 chrUn 77.000 200 37 7 2611 2807 260287235 260287042 5.040000e-19 106.0
51 TraesCS3B01G073000 chr4A 90.244 82 6 2 624 704 661700030 661699950 5.040000e-19 106.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G073000 chr3B 43937213 43940905 3692 True 6820 6820 100.0000 1 3693 1 chr3B.!!$R2 3692
1 TraesCS3B01G073000 chr3B 44042693 44046385 3692 True 6798 6798 99.8920 1 3693 1 chr3B.!!$R3 3692
2 TraesCS3B01G073000 chr3B 607414795 607415427 632 True 342 523 88.0605 965 1633 2 chr3B.!!$R6 668
3 TraesCS3B01G073000 chr3D 26303751 26306300 2549 True 3522 3522 91.9100 848 3360 1 chr3D.!!$R3 2512
4 TraesCS3B01G073000 chr3A 36303033 36305276 2243 True 423 749 89.0680 852 3360 3 chr3A.!!$R3 2508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
22 23 4.742201 CGTGTCGGTGAGCTGGGG 62.742 72.222 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3550 3702 9.240734 AGATTTTGAAGCTAACATTCAGAAGAT 57.759 29.63 0.0 0.0 37.91 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 4.742201 CGTGTCGGTGAGCTGGGG 62.742 72.222 0.0 0.0 0.0 4.96
194 195 7.819415 TCATAGCCTTTGAATCCTCGTATAATG 59.181 37.037 0.0 0.0 0.0 1.90
349 350 8.122952 GTCCAAATGATAAACGGTGAAGATAAG 58.877 37.037 0.0 0.0 0.0 1.73
3550 3702 1.845791 TGAGCAATTCAGGCCCATCTA 59.154 47.619 0.0 0.0 0.0 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
349 350 4.556699 GCGGTTGACCAATAAGATTATGCC 60.557 45.833 0.51 0.0 35.14 4.4
3550 3702 9.240734 AGATTTTGAAGCTAACATTCAGAAGAT 57.759 29.630 0.00 0.0 37.91 2.4


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.