Multiple sequence alignment - TraesCS3B01G065800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G065800 chr3B 100.000 3471 0 0 1 3471 39387396 39383926 0.000000e+00 6410
1 TraesCS3B01G065800 chr3B 99.585 3130 13 0 1 3130 39361826 39358697 0.000000e+00 5709
2 TraesCS3B01G065800 chr3B 99.417 343 2 0 3129 3471 39358562 39358220 1.060000e-174 623
3 TraesCS3B01G065800 chr3B 90.476 84 5 1 2881 2961 380679464 380679547 1.320000e-19 108
4 TraesCS3B01G065800 chr6B 88.943 814 54 19 1 779 77711991 77712803 0.000000e+00 972
5 TraesCS3B01G065800 chr6B 90.055 181 16 2 601 780 155230354 155230175 2.080000e-57 233
6 TraesCS3B01G065800 chr3D 88.821 814 52 21 1 780 583226583 583227391 0.000000e+00 963
7 TraesCS3B01G065800 chr3D 78.376 1207 220 25 1308 2484 569900467 569901662 0.000000e+00 745
8 TraesCS3B01G065800 chr3D 90.361 83 3 3 2881 2963 536333246 536333169 1.700000e-18 104
9 TraesCS3B01G065800 chr5B 87.849 823 60 23 1 784 35615221 35616042 0.000000e+00 929
10 TraesCS3B01G065800 chr5B 79.935 309 60 2 1311 1618 338481528 338481835 3.490000e-55 226
11 TraesCS3B01G065800 chr5B 89.655 87 6 1 2881 2964 51843381 51843295 1.320000e-19 108
12 TraesCS3B01G065800 chr7B 87.533 754 55 28 1 717 673977487 673976736 0.000000e+00 835
13 TraesCS3B01G065800 chr7B 92.129 559 37 5 1 557 418188404 418187851 0.000000e+00 782
14 TraesCS3B01G065800 chr7B 89.535 86 8 1 1227 1312 113163410 113163326 1.320000e-19 108
15 TraesCS3B01G065800 chr2A 92.522 575 36 5 1 568 738783785 738784359 0.000000e+00 817
16 TraesCS3B01G065800 chr1B 93.394 545 31 4 1 540 610350505 610351049 0.000000e+00 802
17 TraesCS3B01G065800 chr1B 89.024 82 6 1 2881 2962 654631584 654631662 7.930000e-17 99
18 TraesCS3B01G065800 chr2B 91.115 574 45 5 1 568 105802567 105801994 0.000000e+00 773
19 TraesCS3B01G065800 chr2B 89.686 223 23 0 558 780 36598980 36599202 5.670000e-73 285
20 TraesCS3B01G065800 chrUn 77.523 1179 209 33 1431 2571 341148674 341147514 0.000000e+00 658
21 TraesCS3B01G065800 chrUn 77.193 1197 217 30 1413 2571 287225073 287226251 0.000000e+00 647
22 TraesCS3B01G065800 chrUn 77.193 1197 217 30 1413 2571 287476971 287478149 0.000000e+00 647
23 TraesCS3B01G065800 chrUn 77.354 1179 211 31 1431 2571 323542264 323541104 0.000000e+00 647
24 TraesCS3B01G065800 chr3A 76.873 1241 229 38 1303 2508 702553974 702555191 0.000000e+00 649
25 TraesCS3B01G065800 chr7D 86.275 561 44 22 251 783 54604366 54604921 2.320000e-161 579
26 TraesCS3B01G065800 chr5A 74.780 1138 238 24 1306 2402 401317398 401316269 1.890000e-127 466
27 TraesCS3B01G065800 chr4A 81.681 464 62 17 337 780 693854972 693854512 7.080000e-97 364
28 TraesCS3B01G065800 chr4A 92.857 84 3 2 2881 2961 589013123 589013040 6.090000e-23 119
29 TraesCS3B01G065800 chr1D 92.574 202 15 0 579 780 222730409 222730610 1.220000e-74 291
30 TraesCS3B01G065800 chr1D 93.631 157 10 0 637 793 435308285 435308129 5.790000e-58 235
31 TraesCS3B01G065800 chr7A 93.103 87 6 0 1227 1313 33885815 33885901 1.010000e-25 128
32 TraesCS3B01G065800 chr6A 92.941 85 5 1 1227 1310 356112251 356112335 4.700000e-24 122
33 TraesCS3B01G065800 chr4D 92.593 81 6 0 1227 1307 467755873 467755793 2.190000e-22 117
34 TraesCS3B01G065800 chr4D 91.463 82 7 0 1226 1307 67330994 67330913 2.830000e-21 113
35 TraesCS3B01G065800 chr6D 90.361 83 8 0 1227 1309 190909354 190909272 3.660000e-20 110
36 TraesCS3B01G065800 chr6D 89.655 87 3 3 2881 2962 470575009 470575094 4.740000e-19 106
37 TraesCS3B01G065800 chr4B 90.476 84 6 1 2881 2964 28406934 28406853 3.660000e-20 110
38 TraesCS3B01G065800 chr4B 89.535 86 5 1 2881 2962 315723358 315723273 4.740000e-19 106
39 TraesCS3B01G065800 chr1A 90.361 83 8 0 1227 1309 382550694 382550776 3.660000e-20 110
40 TraesCS3B01G065800 chr1A 86.139 101 10 4 1217 1315 436259742 436259644 4.740000e-19 106


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G065800 chr3B 39383926 39387396 3470 True 6410 6410 100.000 1 3471 1 chr3B.!!$R1 3470
1 TraesCS3B01G065800 chr3B 39358220 39361826 3606 True 3166 5709 99.501 1 3471 2 chr3B.!!$R2 3470
2 TraesCS3B01G065800 chr6B 77711991 77712803 812 False 972 972 88.943 1 779 1 chr6B.!!$F1 778
3 TraesCS3B01G065800 chr3D 583226583 583227391 808 False 963 963 88.821 1 780 1 chr3D.!!$F2 779
4 TraesCS3B01G065800 chr3D 569900467 569901662 1195 False 745 745 78.376 1308 2484 1 chr3D.!!$F1 1176
5 TraesCS3B01G065800 chr5B 35615221 35616042 821 False 929 929 87.849 1 784 1 chr5B.!!$F1 783
6 TraesCS3B01G065800 chr7B 673976736 673977487 751 True 835 835 87.533 1 717 1 chr7B.!!$R3 716
7 TraesCS3B01G065800 chr7B 418187851 418188404 553 True 782 782 92.129 1 557 1 chr7B.!!$R2 556
8 TraesCS3B01G065800 chr2A 738783785 738784359 574 False 817 817 92.522 1 568 1 chr2A.!!$F1 567
9 TraesCS3B01G065800 chr1B 610350505 610351049 544 False 802 802 93.394 1 540 1 chr1B.!!$F1 539
10 TraesCS3B01G065800 chr2B 105801994 105802567 573 True 773 773 91.115 1 568 1 chr2B.!!$R1 567
11 TraesCS3B01G065800 chrUn 341147514 341148674 1160 True 658 658 77.523 1431 2571 1 chrUn.!!$R2 1140
12 TraesCS3B01G065800 chrUn 287225073 287226251 1178 False 647 647 77.193 1413 2571 1 chrUn.!!$F1 1158
13 TraesCS3B01G065800 chrUn 287476971 287478149 1178 False 647 647 77.193 1413 2571 1 chrUn.!!$F2 1158
14 TraesCS3B01G065800 chrUn 323541104 323542264 1160 True 647 647 77.354 1431 2571 1 chrUn.!!$R1 1140
15 TraesCS3B01G065800 chr3A 702553974 702555191 1217 False 649 649 76.873 1303 2508 1 chr3A.!!$F1 1205
16 TraesCS3B01G065800 chr7D 54604366 54604921 555 False 579 579 86.275 251 783 1 chr7D.!!$F1 532
17 TraesCS3B01G065800 chr5A 401316269 401317398 1129 True 466 466 74.780 1306 2402 1 chr5A.!!$R1 1096

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2130 2223 8.258007 TGACTATTTGATCTTTCCGTATGACTT 58.742 33.333 0.0 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2932 3034 4.324267 CTCCGTCCCAAAATAAGTGTCTT 58.676 43.478 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2130 2223 8.258007 TGACTATTTGATCTTTCCGTATGACTT 58.742 33.333 0.0 0.00 0.00 3.01
2132 2225 9.751542 ACTATTTGATCTTTCCGTATGACTTAG 57.248 33.333 0.0 0.00 0.00 2.18
3000 3102 5.291858 CAGCTTAGTCGTTGCATGATTTCTA 59.708 40.000 0.0 0.00 0.00 2.10
3348 3586 5.245526 AGGTACAGACTCGGTAGAAACAAAT 59.754 40.000 0.0 0.00 0.00 2.32
3445 3683 9.729281 ATGATGCATATCACAAATATGTAGTCA 57.271 29.630 0.0 8.34 45.54 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2130 2223 8.337739 ACTTCTCTTTGTCTATTACTCCCTCTA 58.662 37.037 0.0 0.0 0.00 2.43
2132 2225 7.412853 ACTTCTCTTTGTCTATTACTCCCTC 57.587 40.000 0.0 0.0 0.00 4.30
2932 3034 4.324267 CTCCGTCCCAAAATAAGTGTCTT 58.676 43.478 0.0 0.0 0.00 3.01
3000 3102 5.160607 TGGATACGTCTTGTTCTTTGGAT 57.839 39.130 0.0 0.0 42.51 3.41
3348 3586 4.772231 AGGAAGCCCGAGCCCGTA 62.772 66.667 0.0 0.0 41.25 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.