Multiple sequence alignment - TraesCS3B01G064000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G064000 chr3B 100.000 2348 0 0 1 2348 35768759 35771106 0.000000e+00 4337
1 TraesCS3B01G064000 chr3B 99.872 2348 3 0 1 2348 35696822 35699169 0.000000e+00 4320
2 TraesCS3B01G064000 chr3B 94.737 931 28 8 872 1788 34522533 34521610 0.000000e+00 1428
3 TraesCS3B01G064000 chr3B 94.099 949 29 10 872 1802 35461789 35462728 0.000000e+00 1417
4 TraesCS3B01G064000 chr3B 95.367 885 32 4 1 876 34523455 34522571 0.000000e+00 1399
5 TraesCS3B01G064000 chr3B 95.141 885 34 4 1 876 34468297 34467413 0.000000e+00 1387
6 TraesCS3B01G064000 chr3B 95.141 885 34 4 1 876 35639247 35640131 0.000000e+00 1387
7 TraesCS3B01G064000 chr3B 93.361 949 33 14 872 1802 35573999 35574935 0.000000e+00 1376
8 TraesCS3B01G064000 chr3B 93.361 949 33 14 872 1802 35640169 35641105 0.000000e+00 1376
9 TraesCS3B01G064000 chr3B 94.244 886 39 7 1 876 35460868 35461751 0.000000e+00 1343
10 TraesCS3B01G064000 chr3B 93.622 878 45 8 1 876 35573093 35573961 0.000000e+00 1301
11 TraesCS3B01G064000 chr3B 95.857 531 21 1 1818 2348 34466197 34465668 0.000000e+00 857
12 TraesCS3B01G064000 chr3B 95.131 534 26 0 1815 2348 35817237 35817770 0.000000e+00 843
13 TraesCS3B01G064000 chr3B 95.131 534 26 0 1815 2348 35827327 35827860 0.000000e+00 843
14 TraesCS3B01G064000 chr3B 95.292 531 24 1 1818 2348 34521322 34520793 0.000000e+00 841
15 TraesCS3B01G064000 chr3B 94.944 534 27 0 1815 2348 35748058 35748591 0.000000e+00 837
16 TraesCS3B01G064000 chr3B 92.593 351 9 5 1465 1801 35734310 35734657 2.710000e-134 488
17 TraesCS3B01G064000 chr3B 92.593 351 9 5 1465 1801 35806344 35806691 2.710000e-134 488
18 TraesCS3B01G064000 chrUn 98.303 1945 30 2 1 1945 168646340 168644399 0.000000e+00 3406
19 TraesCS3B01G064000 chrUn 98.400 1375 21 1 1 1375 202841029 202839656 0.000000e+00 2416
20 TraesCS3B01G064000 chrUn 98.328 1376 21 2 1 1375 390422054 390420680 0.000000e+00 2412
21 TraesCS3B01G064000 chrUn 96.891 965 6 1 768 1732 352902381 352901441 0.000000e+00 1594
22 TraesCS3B01G064000 chrUn 89.696 757 38 19 886 1624 43650690 43651424 0.000000e+00 929
23 TraesCS3B01G064000 chrUn 95.318 534 25 0 1815 2348 359842519 359841986 0.000000e+00 848
24 TraesCS3B01G064000 chrUn 94.953 535 26 1 1815 2348 265763340 265763874 0.000000e+00 837
25 TraesCS3B01G064000 chrUn 94.757 534 28 0 1815 2348 338663350 338663883 0.000000e+00 832
26 TraesCS3B01G064000 chrUn 92.593 351 9 5 1465 1801 338662708 338663055 2.710000e-134 488
27 TraesCS3B01G064000 chrUn 92.330 352 10 5 1465 1802 390052014 390051666 3.510000e-133 484
28 TraesCS3B01G064000 chrUn 92.308 351 10 5 1465 1801 257906901 257907248 1.260000e-132 483
29 TraesCS3B01G064000 chrUn 94.853 272 10 3 1532 1802 310491293 310491561 2.790000e-114 422
30 TraesCS3B01G064000 chrUn 86.614 127 11 3 1379 1501 470147063 470147187 4.070000e-28 135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G064000 chr3B 35768759 35771106 2347 False 4337.000000 4337 100.0000 1 2348 1 chr3B.!!$F4 2347
1 TraesCS3B01G064000 chr3B 35696822 35699169 2347 False 4320.000000 4320 99.8720 1 2348 1 chr3B.!!$F1 2347
2 TraesCS3B01G064000 chr3B 35639247 35641105 1858 False 1381.500000 1387 94.2510 1 1802 2 chr3B.!!$F10 1801
3 TraesCS3B01G064000 chr3B 35460868 35462728 1860 False 1380.000000 1417 94.1715 1 1802 2 chr3B.!!$F8 1801
4 TraesCS3B01G064000 chr3B 35573093 35574935 1842 False 1338.500000 1376 93.4915 1 1802 2 chr3B.!!$F9 1801
5 TraesCS3B01G064000 chr3B 34520793 34523455 2662 True 1222.666667 1428 95.1320 1 2348 3 chr3B.!!$R2 2347
6 TraesCS3B01G064000 chr3B 34465668 34468297 2629 True 1122.000000 1387 95.4990 1 2348 2 chr3B.!!$R1 2347
7 TraesCS3B01G064000 chr3B 35817237 35817770 533 False 843.000000 843 95.1310 1815 2348 1 chr3B.!!$F6 533
8 TraesCS3B01G064000 chr3B 35827327 35827860 533 False 843.000000 843 95.1310 1815 2348 1 chr3B.!!$F7 533
9 TraesCS3B01G064000 chr3B 35748058 35748591 533 False 837.000000 837 94.9440 1815 2348 1 chr3B.!!$F3 533
10 TraesCS3B01G064000 chrUn 168644399 168646340 1941 True 3406.000000 3406 98.3030 1 1945 1 chrUn.!!$R1 1944
11 TraesCS3B01G064000 chrUn 202839656 202841029 1373 True 2416.000000 2416 98.4000 1 1375 1 chrUn.!!$R2 1374
12 TraesCS3B01G064000 chrUn 390420680 390422054 1374 True 2412.000000 2412 98.3280 1 1375 1 chrUn.!!$R6 1374
13 TraesCS3B01G064000 chrUn 352901441 352902381 940 True 1594.000000 1594 96.8910 768 1732 1 chrUn.!!$R3 964
14 TraesCS3B01G064000 chrUn 43650690 43651424 734 False 929.000000 929 89.6960 886 1624 1 chrUn.!!$F1 738
15 TraesCS3B01G064000 chrUn 359841986 359842519 533 True 848.000000 848 95.3180 1815 2348 1 chrUn.!!$R4 533
16 TraesCS3B01G064000 chrUn 265763340 265763874 534 False 837.000000 837 94.9530 1815 2348 1 chrUn.!!$F3 533
17 TraesCS3B01G064000 chrUn 338662708 338663883 1175 False 660.000000 832 93.6750 1465 2348 2 chrUn.!!$F6 883

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
300 304 2.21675 GATGCATGGCCGTGCTTGTT 62.217 55.0 41.48 26.9 45.27 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1681 1806 3.858503 GCTTGGAGCAACAAACTGGAATC 60.859 47.826 0.0 0.0 41.89 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
300 304 2.216750 GATGCATGGCCGTGCTTGTT 62.217 55.000 41.48 26.9 45.27 2.83
1681 1806 1.135575 GCAAGACTGGGAAAGCATTCG 60.136 52.381 0.00 0.0 36.36 3.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
300 304 1.523154 GGCACGGATTTGCTTCCACA 61.523 55.000 0.0 0.0 42.56 4.17
1681 1806 3.858503 GCTTGGAGCAACAAACTGGAATC 60.859 47.826 0.0 0.0 41.89 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.