Multiple sequence alignment - TraesCS3B01G063500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G063500 chr3B 100.000 2348 0 0 1 2348 35639294 35641641 0 4337
1 TraesCS3B01G063500 chr3B 99.020 2348 8 1 1 2348 35573139 35575471 0 4194
2 TraesCS3B01G063500 chr3B 97.494 2354 49 8 1 2348 35460915 35463264 0 4012
3 TraesCS3B01G063500 chr3B 96.602 2354 47 7 1 2348 34523409 34521083 0 3873
4 TraesCS3B01G063500 chr3B 95.587 1337 27 6 1017 2348 34467267 34465958 0 2113
5 TraesCS3B01G063500 chr3B 98.686 989 12 1 1 988 34468251 34467263 0 1753
6 TraesCS3B01G063500 chr3B 96.836 885 23 4 1469 2348 35734310 35735194 0 1474
7 TraesCS3B01G063500 chr3B 96.723 885 24 4 1469 2348 35806344 35807228 0 1469
8 TraesCS3B01G063500 chr3B 96.610 885 25 4 1469 2348 35816595 35817479 0 1463
9 TraesCS3B01G063500 chr3B 96.497 885 26 4 1469 2348 35747416 35748300 0 1458
10 TraesCS3B01G063500 chr3B 96.384 885 27 4 1469 2348 35826685 35827569 0 1452
11 TraesCS3B01G063500 chr3B 93.361 949 33 14 876 1812 35697693 35698623 0 1376
12 TraesCS3B01G063500 chr3B 93.361 949 33 14 876 1812 35769630 35770560 0 1376
13 TraesCS3B01G063500 chr3B 95.227 838 32 3 1 838 35696868 35697697 0 1319
14 TraesCS3B01G063500 chr3B 95.107 838 33 3 1 838 35768805 35769634 0 1314
15 TraesCS3B01G063500 chr3B 80.573 1292 172 47 620 1881 35212028 35213270 0 922
16 TraesCS3B01G063500 chr3B 80.573 1292 172 45 620 1881 35288212 35289454 0 922
17 TraesCS3B01G063500 chrUn 96.723 885 24 4 1469 2348 338662708 338663592 0 1469
18 TraesCS3B01G063500 chrUn 97.746 843 19 0 1506 2348 265762740 265763582 0 1452
19 TraesCS3B01G063500 chrUn 93.770 947 31 14 876 1812 168645470 168644542 0 1397
20 TraesCS3B01G063500 chrUn 96.062 838 24 4 1 838 202840983 202840155 0 1356
21 TraesCS3B01G063500 chrUn 95.948 839 24 5 1 838 390422008 390421179 0 1352
22 TraesCS3B01G063500 chrUn 95.943 838 25 4 1 838 168646294 168645466 0 1351
23 TraesCS3B01G063500 chrUn 91.240 879 25 22 876 1744 352902277 352901441 0 1149
24 TraesCS3B01G063500 chrUn 96.825 504 12 3 876 1375 202840159 202839656 0 839


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G063500 chr3B 35639294 35641641 2347 False 4337.0 4337 100.0000 1 2348 1 chr3B.!!$F5 2347
1 TraesCS3B01G063500 chr3B 35573139 35575471 2332 False 4194.0 4194 99.0200 1 2348 1 chr3B.!!$F4 2347
2 TraesCS3B01G063500 chr3B 35460915 35463264 2349 False 4012.0 4012 97.4940 1 2348 1 chr3B.!!$F3 2347
3 TraesCS3B01G063500 chr3B 34521083 34523409 2326 True 3873.0 3873 96.6020 1 2348 1 chr3B.!!$R1 2347
4 TraesCS3B01G063500 chr3B 34465958 34468251 2293 True 1933.0 2113 97.1365 1 2348 2 chr3B.!!$R2 2347
5 TraesCS3B01G063500 chr3B 35734310 35735194 884 False 1474.0 1474 96.8360 1469 2348 1 chr3B.!!$F6 879
6 TraesCS3B01G063500 chr3B 35806344 35807228 884 False 1469.0 1469 96.7230 1469 2348 1 chr3B.!!$F8 879
7 TraesCS3B01G063500 chr3B 35816595 35817479 884 False 1463.0 1463 96.6100 1469 2348 1 chr3B.!!$F9 879
8 TraesCS3B01G063500 chr3B 35747416 35748300 884 False 1458.0 1458 96.4970 1469 2348 1 chr3B.!!$F7 879
9 TraesCS3B01G063500 chr3B 35826685 35827569 884 False 1452.0 1452 96.3840 1469 2348 1 chr3B.!!$F10 879
10 TraesCS3B01G063500 chr3B 35696868 35698623 1755 False 1347.5 1376 94.2940 1 1812 2 chr3B.!!$F11 1811
11 TraesCS3B01G063500 chr3B 35768805 35770560 1755 False 1345.0 1376 94.2340 1 1812 2 chr3B.!!$F12 1811
12 TraesCS3B01G063500 chr3B 35212028 35213270 1242 False 922.0 922 80.5730 620 1881 1 chr3B.!!$F1 1261
13 TraesCS3B01G063500 chr3B 35288212 35289454 1242 False 922.0 922 80.5730 620 1881 1 chr3B.!!$F2 1261
14 TraesCS3B01G063500 chrUn 338662708 338663592 884 False 1469.0 1469 96.7230 1469 2348 1 chrUn.!!$F2 879
15 TraesCS3B01G063500 chrUn 265762740 265763582 842 False 1452.0 1452 97.7460 1506 2348 1 chrUn.!!$F1 842
16 TraesCS3B01G063500 chrUn 168644542 168646294 1752 True 1374.0 1397 94.8565 1 1812 2 chrUn.!!$R3 1811
17 TraesCS3B01G063500 chrUn 390421179 390422008 829 True 1352.0 1352 95.9480 1 838 1 chrUn.!!$R2 837
18 TraesCS3B01G063500 chrUn 352901441 352902277 836 True 1149.0 1149 91.2400 876 1744 1 chrUn.!!$R1 868
19 TraesCS3B01G063500 chrUn 202839656 202840983 1327 True 1097.5 1356 96.4435 1 1375 2 chrUn.!!$R4 1374

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
949 960 7.65939 ACAATCACTTAGCAAATCTAGCTATCC 59.341 37.037 0.0 0.0 43.48 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2141 2226 0.753867 TTGTACCCTGTCAGAACGCA 59.246 50.0 0.0 0.0 0.0 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
949 960 7.659390 ACAATCACTTAGCAAATCTAGCTATCC 59.341 37.037 0.00 0.0 43.48 2.59
2141 2226 6.969043 TGGATCCAATCACAGTAATAAACCT 58.031 36.000 13.46 0.0 0.00 3.50
2245 2330 1.815421 CGCTACAGGTGGACCATGC 60.815 63.158 0.00 0.0 38.89 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
949 960 1.270412 GAGCTCAGGCAGAGATGATGG 60.270 57.143 11.48 0.0 44.5 3.51
2141 2226 0.753867 TTGTACCCTGTCAGAACGCA 59.246 50.000 0.00 0.0 0.0 5.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.