Multiple sequence alignment - TraesCS3B01G063100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G063100 chr3B 100.000 2348 0 0 1 2348 35287587 35289934 0.000000e+00 4337
1 TraesCS3B01G063100 chr3B 99.659 2348 7 1 1 2348 35211404 35213750 0.000000e+00 4290
2 TraesCS3B01G063100 chr3B 96.608 1297 38 3 328 1620 35700774 35702068 0.000000e+00 2146
3 TraesCS3B01G063100 chr3B 96.608 1297 38 3 328 1620 35772710 35774004 0.000000e+00 2146
4 TraesCS3B01G063100 chr3B 97.970 739 11 3 1614 2348 35706982 35707720 0.000000e+00 1279
5 TraesCS3B01G063100 chr3B 97.970 739 11 3 1614 2348 35779100 35779838 0.000000e+00 1279
6 TraesCS3B01G063100 chr3B 81.294 1283 168 34 627 1862 35461534 35462791 0.000000e+00 974
7 TraesCS3B01G063100 chr3B 80.670 1283 172 44 626 1868 35573758 35575004 0.000000e+00 926
8 TraesCS3B01G063100 chr3B 80.150 1204 171 43 625 1784 34522790 34521611 0.000000e+00 837
9 TraesCS3B01G063100 chr3B 80.561 962 118 35 875 1799 35769631 35770560 0.000000e+00 676
10 TraesCS3B01G063100 chr3B 82.767 795 91 28 1020 1784 34467264 34466486 0.000000e+00 667
11 TraesCS3B01G063100 chr3B 90.988 344 15 5 1 328 35466530 35466873 1.280000e-122 449
12 TraesCS3B01G063100 chr3B 90.379 343 17 5 1 327 35700513 35700855 9.960000e-119 436
13 TraesCS3B01G063100 chr3B 89.826 344 19 5 1 328 35579324 35579667 6.000000e-116 427
14 TraesCS3B01G063100 chr3B 85.057 174 13 1 561 734 35821638 35821798 5.190000e-37 165
15 TraesCS3B01G063100 chrUn 97.448 1293 31 2 328 1620 168642432 168641142 0.000000e+00 2204
16 TraesCS3B01G063100 chrUn 97.692 1040 23 1 328 1367 386579229 386578191 0.000000e+00 1786
17 TraesCS3B01G063100 chrUn 98.106 739 10 3 1614 2348 168634364 168633626 0.000000e+00 1284
18 TraesCS3B01G063100 chrUn 97.970 739 11 3 1614 2348 202832775 202832037 0.000000e+00 1279
19 TraesCS3B01G063100 chrUn 97.970 739 11 3 1614 2348 299844220 299843482 0.000000e+00 1279
20 TraesCS3B01G063100 chrUn 97.970 739 11 3 1614 2348 341072196 341072934 0.000000e+00 1279
21 TraesCS3B01G063100 chrUn 87.226 1049 99 24 561 1599 43664393 43665416 0.000000e+00 1162
22 TraesCS3B01G063100 chrUn 98.292 644 7 3 1709 2348 205373186 205372543 0.000000e+00 1125
23 TraesCS3B01G063100 chrUn 98.292 644 7 3 1709 2348 341298609 341299252 0.000000e+00 1125
24 TraesCS3B01G063100 chrUn 86.350 674 78 8 888 1553 43650690 43651357 0.000000e+00 723
25 TraesCS3B01G063100 chrUn 90.087 343 18 5 1 327 168642693 168642351 4.640000e-117 431
26 TraesCS3B01G063100 chrUn 90.087 343 18 5 1 327 386579490 386579148 4.640000e-117 431
27 TraesCS3B01G063100 chrUn 89.535 344 20 4 1 328 168713910 168713567 2.790000e-114 422
28 TraesCS3B01G063100 chrUn 89.244 344 21 4 1 328 359898849 359899192 1.300000e-112 416
29 TraesCS3B01G063100 chrUn 89.244 344 21 4 1 328 359900940 359901283 1.300000e-112 416
30 TraesCS3B01G063100 chrUn 88.081 344 21 8 1 328 265767639 265767978 7.870000e-105 390
31 TraesCS3B01G063100 chrUn 88.081 344 21 8 1 328 335745791 335746130 7.870000e-105 390
32 TraesCS3B01G063100 chrUn 88.081 344 21 8 1 328 340150888 340151227 7.870000e-105 390
33 TraesCS3B01G063100 chrUn 92.887 239 16 1 328 566 168711655 168711418 1.730000e-91 346
34 TraesCS3B01G063100 chrUn 92.887 239 16 1 328 566 168713649 168713412 1.730000e-91 346
35 TraesCS3B01G063100 chrUn 93.562 233 14 1 328 560 340151145 340151376 1.730000e-91 346
36 TraesCS3B01G063100 chrUn 93.562 233 14 1 328 560 359899110 359899341 1.730000e-91 346
37 TraesCS3B01G063100 chrUn 89.388 245 10 4 1 229 202838339 202838095 6.350000e-76 294
38 TraesCS3B01G063100 chrUn 89.388 245 10 4 1 229 352900499 352900255 6.350000e-76 294
39 TraesCS3B01G063100 chrUn 85.632 174 12 1 561 734 265768166 265768326 1.120000e-38 171
40 TraesCS3B01G063100 chrUn 85.632 174 12 1 561 734 335746318 335746478 1.120000e-38 171
41 TraesCS3B01G063100 chrUn 85.632 174 12 1 561 734 340151415 340151575 1.120000e-38 171
42 TraesCS3B01G063100 chrUn 85.057 174 13 1 561 734 359899380 359899540 5.190000e-37 165
43 TraesCS3B01G063100 chrUn 85.057 174 13 1 561 734 359901471 359901631 5.190000e-37 165
44 TraesCS3B01G063100 chrUn 93.878 49 3 0 1572 1620 168639621 168639573 9.000000e-10 75
45 TraesCS3B01G063100 chrUn 93.878 49 3 0 1572 1620 202838084 202838036 9.000000e-10 75


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G063100 chr3B 35287587 35289934 2347 False 4337.000000 4337 100.000000 1 2348 1 chr3B.!!$F2 2347
1 TraesCS3B01G063100 chr3B 35211404 35213750 2346 False 4290.000000 4290 99.659000 1 2348 1 chr3B.!!$F1 2347
2 TraesCS3B01G063100 chr3B 35769631 35774004 4373 False 1411.000000 2146 88.584500 328 1799 2 chr3B.!!$F10 1471
3 TraesCS3B01G063100 chr3B 35700513 35702068 1555 False 1291.000000 2146 93.493500 1 1620 2 chr3B.!!$F9 1619
4 TraesCS3B01G063100 chr3B 35706982 35707720 738 False 1279.000000 1279 97.970000 1614 2348 1 chr3B.!!$F5 734
5 TraesCS3B01G063100 chr3B 35779100 35779838 738 False 1279.000000 1279 97.970000 1614 2348 1 chr3B.!!$F6 734
6 TraesCS3B01G063100 chr3B 35573758 35575004 1246 False 926.000000 926 80.670000 626 1868 1 chr3B.!!$F3 1242
7 TraesCS3B01G063100 chr3B 34521611 34522790 1179 True 837.000000 837 80.150000 625 1784 1 chr3B.!!$R2 1159
8 TraesCS3B01G063100 chr3B 35461534 35466873 5339 False 711.500000 974 86.141000 1 1862 2 chr3B.!!$F8 1861
9 TraesCS3B01G063100 chr3B 34466486 34467264 778 True 667.000000 667 82.767000 1020 1784 1 chr3B.!!$R1 764
10 TraesCS3B01G063100 chrUn 168633626 168634364 738 True 1284.000000 1284 98.106000 1614 2348 1 chrUn.!!$R1 734
11 TraesCS3B01G063100 chrUn 202832037 202832775 738 True 1279.000000 1279 97.970000 1614 2348 1 chrUn.!!$R2 734
12 TraesCS3B01G063100 chrUn 299843482 299844220 738 True 1279.000000 1279 97.970000 1614 2348 1 chrUn.!!$R4 734
13 TraesCS3B01G063100 chrUn 341072196 341072934 738 False 1279.000000 1279 97.970000 1614 2348 1 chrUn.!!$F3 734
14 TraesCS3B01G063100 chrUn 43664393 43665416 1023 False 1162.000000 1162 87.226000 561 1599 1 chrUn.!!$F2 1038
15 TraesCS3B01G063100 chrUn 205372543 205373186 643 True 1125.000000 1125 98.292000 1709 2348 1 chrUn.!!$R3 639
16 TraesCS3B01G063100 chrUn 341298609 341299252 643 False 1125.000000 1125 98.292000 1709 2348 1 chrUn.!!$F4 639
17 TraesCS3B01G063100 chrUn 386578191 386579490 1299 True 1108.500000 1786 93.889500 1 1367 2 chrUn.!!$R9 1366
18 TraesCS3B01G063100 chrUn 168639573 168642693 3120 True 903.333333 2204 93.804333 1 1620 3 chrUn.!!$R6 1619
19 TraesCS3B01G063100 chrUn 43650690 43651357 667 False 723.000000 723 86.350000 888 1553 1 chrUn.!!$F1 665
20 TraesCS3B01G063100 chrUn 168711418 168713910 2492 True 371.333333 422 91.769667 1 566 3 chrUn.!!$R7 565
21 TraesCS3B01G063100 chrUn 340150888 340151575 687 False 302.333333 390 89.091667 1 734 3 chrUn.!!$F7 733
22 TraesCS3B01G063100 chrUn 359898849 359901631 2782 False 301.600000 416 88.432800 1 734 5 chrUn.!!$F8 733
23 TraesCS3B01G063100 chrUn 265767639 265768326 687 False 280.500000 390 86.856500 1 734 2 chrUn.!!$F5 733
24 TraesCS3B01G063100 chrUn 335745791 335746478 687 False 280.500000 390 86.856500 1 734 2 chrUn.!!$F6 733

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
92 2184 1.942223 GCCGACCAAAACAACGTGC 60.942 57.895 0.0 0.0 0.0 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1678 3901 8.651859 CTTAGAGCAAGAAACTGGAATGGAACA 61.652 40.741 0.0 0.0 38.86 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 2184 1.942223 GCCGACCAAAACAACGTGC 60.942 57.895 0.00 0.0 0.00 5.34
240 2348 2.489329 CGCCACTTGTGGATCAAAAGAT 59.511 45.455 22.52 0.0 32.81 2.40
385 2493 2.331893 CCCGATGCGACAAAGCCAA 61.332 57.895 0.00 0.0 36.02 4.52
1678 3901 4.100963 TGATATACGCATGACTGGGAAAGT 59.899 41.667 0.00 0.0 43.85 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 2184 1.444553 GCTCGTCTCCGGACACAAG 60.445 63.158 10.65 1.74 42.21 3.16
240 2348 2.364324 GTTGTACCGCTCCCATCTATGA 59.636 50.000 0.00 0.00 0.00 2.15
1678 3901 8.651859 CTTAGAGCAAGAAACTGGAATGGAACA 61.652 40.741 0.00 0.00 38.86 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.