Multiple sequence alignment - TraesCS3B01G062700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G062700 chr3B 100.000 2453 0 0 1 2453 34523513 34521061 0.000000e+00 4530.0
1 TraesCS3B01G062700 chr3B 96.613 2480 51 7 1 2453 35639190 35641663 0.000000e+00 4084.0
2 TraesCS3B01G062700 chr3B 96.169 2480 47 8 1 2453 35573035 35575493 0.000000e+00 4010.0
3 TraesCS3B01G062700 chr3B 95.929 2481 69 6 1 2453 35460810 35463286 0.000000e+00 3993.0
4 TraesCS3B01G062700 chr3B 99.549 1330 6 0 1122 2451 34467267 34465938 0.000000e+00 2423.0
5 TraesCS3B01G062700 chr3B 98.994 1093 11 0 1 1093 34468355 34467263 0.000000e+00 1958.0
6 TraesCS3B01G062700 chr3B 95.440 943 34 4 1 943 35696764 35697697 0.000000e+00 1495.0
7 TraesCS3B01G062700 chr3B 95.334 943 35 4 1 943 35768701 35769634 0.000000e+00 1489.0
8 TraesCS3B01G062700 chr3B 94.737 931 28 8 981 1904 35697693 35698609 0.000000e+00 1428.0
9 TraesCS3B01G062700 chr3B 94.737 931 28 8 981 1904 35769630 35770546 0.000000e+00 1428.0
10 TraesCS3B01G062700 chr3B 94.487 907 27 1 1570 2453 35734310 35735216 0.000000e+00 1376.0
11 TraesCS3B01G062700 chr3B 94.377 907 28 1 1570 2453 35806344 35807250 0.000000e+00 1371.0
12 TraesCS3B01G062700 chr3B 94.377 907 28 1 1570 2453 35826685 35827591 0.000000e+00 1371.0
13 TraesCS3B01G062700 chr3B 94.267 907 29 1 1570 2453 35816595 35817501 0.000000e+00 1365.0
14 TraesCS3B01G062700 chr3B 98.077 52 1 0 1484 1535 35733174 35733225 9.340000e-15 91.6
15 TraesCS3B01G062700 chr3B 98.000 50 1 0 1484 1533 35805224 35805273 1.210000e-13 87.9
16 TraesCS3B01G062700 chrUn 96.076 943 27 4 1 943 168646398 168645466 0.000000e+00 1528.0
17 TraesCS3B01G062700 chrUn 96.076 943 27 4 1 943 202841087 202840155 0.000000e+00 1528.0
18 TraesCS3B01G062700 chrUn 96.081 944 26 5 1 943 390422112 390421179 0.000000e+00 1528.0
19 TraesCS3B01G062700 chrUn 95.264 929 25 9 981 1904 168645470 168644556 0.000000e+00 1454.0
20 TraesCS3B01G062700 chrUn 94.377 907 28 1 1570 2453 338662708 338663614 0.000000e+00 1371.0
21 TraesCS3B01G062700 chrUn 94.604 871 24 2 1606 2453 265762734 265763604 0.000000e+00 1327.0
22 TraesCS3B01G062700 chrUn 94.604 871 24 2 1606 2453 359843125 359842255 0.000000e+00 1327.0
23 TraesCS3B01G062700 chrUn 94.573 866 24 1 1570 2412 364390240 364389375 0.000000e+00 1317.0
24 TraesCS3B01G062700 chrUn 92.686 875 21 10 981 1850 352902277 352901441 0.000000e+00 1221.0
25 TraesCS3B01G062700 chrUn 96.627 504 13 3 981 1480 202840159 202839656 0.000000e+00 833.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G062700 chr3B 34521061 34523513 2452 True 4530.00 4530 100.0000 1 2453 1 chr3B.!!$R1 2452
1 TraesCS3B01G062700 chr3B 35639190 35641663 2473 False 4084.00 4084 96.6130 1 2453 1 chr3B.!!$F3 2452
2 TraesCS3B01G062700 chr3B 35573035 35575493 2458 False 4010.00 4010 96.1690 1 2453 1 chr3B.!!$F2 2452
3 TraesCS3B01G062700 chr3B 35460810 35463286 2476 False 3993.00 3993 95.9290 1 2453 1 chr3B.!!$F1 2452
4 TraesCS3B01G062700 chr3B 34465938 34468355 2417 True 2190.50 2423 99.2715 1 2451 2 chr3B.!!$R2 2450
5 TraesCS3B01G062700 chr3B 35696764 35698609 1845 False 1461.50 1495 95.0885 1 1904 2 chr3B.!!$F6 1903
6 TraesCS3B01G062700 chr3B 35768701 35770546 1845 False 1458.50 1489 95.0355 1 1904 2 chr3B.!!$F8 1903
7 TraesCS3B01G062700 chr3B 35826685 35827591 906 False 1371.00 1371 94.3770 1570 2453 1 chr3B.!!$F5 883
8 TraesCS3B01G062700 chr3B 35816595 35817501 906 False 1365.00 1365 94.2670 1570 2453 1 chr3B.!!$F4 883
9 TraesCS3B01G062700 chr3B 35733174 35735216 2042 False 733.80 1376 96.2820 1484 2453 2 chr3B.!!$F7 969
10 TraesCS3B01G062700 chr3B 35805224 35807250 2026 False 729.45 1371 96.1885 1484 2453 2 chr3B.!!$F9 969
11 TraesCS3B01G062700 chrUn 390421179 390422112 933 True 1528.00 1528 96.0810 1 943 1 chrUn.!!$R4 942
12 TraesCS3B01G062700 chrUn 168644556 168646398 1842 True 1491.00 1528 95.6700 1 1904 2 chrUn.!!$R5 1903
13 TraesCS3B01G062700 chrUn 338662708 338663614 906 False 1371.00 1371 94.3770 1570 2453 1 chrUn.!!$F2 883
14 TraesCS3B01G062700 chrUn 265762734 265763604 870 False 1327.00 1327 94.6040 1606 2453 1 chrUn.!!$F1 847
15 TraesCS3B01G062700 chrUn 359842255 359843125 870 True 1327.00 1327 94.6040 1606 2453 1 chrUn.!!$R2 847
16 TraesCS3B01G062700 chrUn 364389375 364390240 865 True 1317.00 1317 94.5730 1570 2412 1 chrUn.!!$R3 842
17 TraesCS3B01G062700 chrUn 352901441 352902277 836 True 1221.00 1221 92.6860 981 1850 1 chrUn.!!$R1 869
18 TraesCS3B01G062700 chrUn 202839656 202841087 1431 True 1180.50 1528 96.3515 1 1480 2 chrUn.!!$R6 1479

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
775 778 0.966875 TTCCACCGCTAGAACGCCTA 60.967 55.0 0.0 0.0 0.0 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2358 3447 1.966901 TATGTCCATCCGTGCGCCTT 61.967 55.0 4.18 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 117 4.524328 GTCCAAATCCTGAACCATTTCACT 59.476 41.667 0.0 0.0 36.79 3.41
240 242 1.343142 GCACGGTTTTCCCTTTCCAAT 59.657 47.619 0.0 0.0 36.42 3.16
775 778 0.966875 TTCCACCGCTAGAACGCCTA 60.967 55.000 0.0 0.0 0.00 3.93
1120 1127 1.522580 GAGATGGCCCGTTCTGCTC 60.523 63.158 0.0 0.0 0.00 4.26
1555 1624 3.133183 ACACACGCACACCCACATATATA 59.867 43.478 0.0 0.0 0.00 0.86
1691 2754 1.001633 TCCCCGAGTTTGCTGTACTTC 59.998 52.381 0.0 0.0 0.00 3.01
2008 3097 5.635278 ATCACCATCATCCAATACACTGA 57.365 39.130 0.0 0.0 0.00 3.41
2406 3495 3.181493 CCATGCTAATTTGAGTCAGGTGC 60.181 47.826 0.0 0.0 0.00 5.01
2421 3510 4.746611 GTCAGGTGCTTGAATTTTTCCAAG 59.253 41.667 0.0 0.0 41.84 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 117 1.445410 CGACGCGAGGAATCCAACA 60.445 57.895 15.93 0.0 0.00 3.33
240 242 1.740380 GCGAGAAGCTTGGTCATGCTA 60.740 52.381 2.10 0.0 40.38 3.49
775 778 2.171448 GGATGGACCAAGCACTACATCT 59.829 50.000 0.00 0.0 38.79 2.90
1120 1127 2.091112 CGAGCACGACCTGAGCAAG 61.091 63.158 0.00 0.0 42.66 4.01
2358 3447 1.966901 TATGTCCATCCGTGCGCCTT 61.967 55.000 4.18 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.