Multiple sequence alignment - TraesCS3B01G055200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G055200 chr3B 100.000 2987 0 0 1 2987 28531072 28528086 0.000000e+00 5517
1 TraesCS3B01G055200 chr3B 98.026 2989 53 4 1 2987 28519663 28516679 0.000000e+00 5188
2 TraesCS3B01G055200 chr3B 96.928 2995 81 3 1 2987 28410490 28407499 0.000000e+00 5011
3 TraesCS3B01G055200 chr3B 96.891 2991 87 2 3 2987 28457000 28454010 0.000000e+00 5003
4 TraesCS3B01G055200 chr3B 96.661 2995 89 3 1 2987 28423654 28420663 0.000000e+00 4966
5 TraesCS3B01G055200 chr3B 95.269 2748 107 9 257 2987 28564194 28561453 0.000000e+00 4335
6 TraesCS3B01G055200 chr3B 91.223 2894 183 19 154 2987 14024363 14021481 0.000000e+00 3871
7 TraesCS3B01G055200 chr3B 91.649 2778 187 13 154 2897 14066606 14063840 0.000000e+00 3803
8 TraesCS3B01G055200 chr3B 96.817 2262 69 1 729 2987 28492700 28490439 0.000000e+00 3775
9 TraesCS3B01G055200 chr3B 97.690 606 13 1 2382 2987 28468127 28467523 0.000000e+00 1040
10 TraesCS3B01G055200 chr3B 96.667 150 5 0 1 150 28396218 28396069 1.780000e-62 250
11 TraesCS3B01G055200 chr3B 96.667 150 5 0 1 150 28442123 28441974 1.780000e-62 250
12 TraesCS3B01G055200 chrUn 95.425 2492 100 8 504 2987 307487399 307489884 0.000000e+00 3958
13 TraesCS3B01G055200 chrUn 95.345 2492 102 8 504 2987 328827719 328830204 0.000000e+00 3947
14 TraesCS3B01G055200 chrUn 97.561 246 6 0 257 502 37979290 37979045 3.560000e-114 422
15 TraesCS3B01G055200 chr3D 84.132 2899 331 46 154 2987 9949189 9946355 0.000000e+00 2686
16 TraesCS3B01G055200 chr3D 85.930 597 66 15 154 742 5682515 5681929 3.270000e-174 621
17 TraesCS3B01G055200 chr2A 83.483 2004 252 26 1035 2984 19663177 19661199 0.000000e+00 1794
18 TraesCS3B01G055200 chr2A 86.203 790 86 12 184 968 19663943 19663172 0.000000e+00 833
19 TraesCS3B01G055200 chr7B 94.667 150 8 0 1 150 125938974 125938825 1.790000e-57 233
20 TraesCS3B01G055200 chr7B 93.333 150 10 0 1 150 4646149 4646298 3.880000e-54 222
21 TraesCS3B01G055200 chr6B 93.243 148 10 0 3 150 166895880 166895733 5.010000e-53 219


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G055200 chr3B 28528086 28531072 2986 True 5517.0 5517 100.000 1 2987 1 chr3B.!!$R11 2986
1 TraesCS3B01G055200 chr3B 28516679 28519663 2984 True 5188.0 5188 98.026 1 2987 1 chr3B.!!$R10 2986
2 TraesCS3B01G055200 chr3B 28407499 28410490 2991 True 5011.0 5011 96.928 1 2987 1 chr3B.!!$R4 2986
3 TraesCS3B01G055200 chr3B 28454010 28457000 2990 True 5003.0 5003 96.891 3 2987 1 chr3B.!!$R7 2984
4 TraesCS3B01G055200 chr3B 28420663 28423654 2991 True 4966.0 4966 96.661 1 2987 1 chr3B.!!$R5 2986
5 TraesCS3B01G055200 chr3B 28561453 28564194 2741 True 4335.0 4335 95.269 257 2987 1 chr3B.!!$R12 2730
6 TraesCS3B01G055200 chr3B 14021481 14024363 2882 True 3871.0 3871 91.223 154 2987 1 chr3B.!!$R1 2833
7 TraesCS3B01G055200 chr3B 14063840 14066606 2766 True 3803.0 3803 91.649 154 2897 1 chr3B.!!$R2 2743
8 TraesCS3B01G055200 chr3B 28490439 28492700 2261 True 3775.0 3775 96.817 729 2987 1 chr3B.!!$R9 2258
9 TraesCS3B01G055200 chr3B 28467523 28468127 604 True 1040.0 1040 97.690 2382 2987 1 chr3B.!!$R8 605
10 TraesCS3B01G055200 chrUn 307487399 307489884 2485 False 3958.0 3958 95.425 504 2987 1 chrUn.!!$F1 2483
11 TraesCS3B01G055200 chrUn 328827719 328830204 2485 False 3947.0 3947 95.345 504 2987 1 chrUn.!!$F2 2483
12 TraesCS3B01G055200 chr3D 9946355 9949189 2834 True 2686.0 2686 84.132 154 2987 1 chr3D.!!$R2 2833
13 TraesCS3B01G055200 chr3D 5681929 5682515 586 True 621.0 621 85.930 154 742 1 chr3D.!!$R1 588
14 TraesCS3B01G055200 chr2A 19661199 19663943 2744 True 1313.5 1794 84.843 184 2984 2 chr2A.!!$R1 2800

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
862 907 0.106918 AAGTTTGGCGTGAGACCCAA 60.107 50.000 0.0 0.0 39.67 4.12 F
1551 1621 1.152984 CACTGTCCACTTGGTGCCA 60.153 57.895 0.0 0.0 36.34 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1782 1855 0.251297 CCATGTCCTCCTTGCCACAA 60.251 55.0 0.0 0.0 0.00 3.33 R
2766 2931 2.029649 TCTAAAAGTCGGGAGTTGTCCG 60.030 50.0 0.0 0.0 45.05 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
102 103 2.575694 ACAAACTTTGCGTGCATGAA 57.424 40.000 10.93 0.0 0.00 2.57
131 132 3.454812 AGTATGCGGGAGAAACTTACCAT 59.545 43.478 0.00 0.0 0.00 3.55
417 422 1.746991 TGTGGCGTTTGTGTGCTCA 60.747 52.632 0.00 0.0 0.00 4.26
862 907 0.106918 AAGTTTGGCGTGAGACCCAA 60.107 50.000 0.00 0.0 39.67 4.12
899 944 2.278330 CCCAAAGGCCAGCCAAGAC 61.278 63.158 12.03 0.0 38.92 3.01
1443 1513 1.367471 CCACGAGGTCACTGAGCAA 59.633 57.895 10.78 0.0 31.89 3.91
1551 1621 1.152984 CACTGTCCACTTGGTGCCA 60.153 57.895 0.00 0.0 36.34 4.92
1591 1661 1.602311 CAAGGTCAGCAAGCTTCAGT 58.398 50.000 0.00 0.0 43.77 3.41
1875 1948 2.908015 GGCGAGCCCACATTCCTA 59.092 61.111 1.97 0.0 0.00 2.94
1951 2033 2.124612 CCCTGCACATCCGCATCA 60.125 61.111 0.00 0.0 42.06 3.07
2004 2092 2.168521 GTGATTAGGTCCACTGCTGCTA 59.831 50.000 0.00 0.0 0.00 3.49
2080 2176 7.605449 CATCTGAAACTATTTGGGTGATGTTT 58.395 34.615 0.00 0.0 0.00 2.83
2094 2192 7.517320 TGGGTGATGTTTATTAGTAGATGCAT 58.483 34.615 0.00 0.0 0.00 3.96
2165 2263 7.792374 ATTATGCTTCGTGTTAATCATGTCT 57.208 32.000 0.00 0.0 34.87 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
102 103 1.717032 TCTCCCGCATACTAGCCAAT 58.283 50.000 0.00 0.00 0.00 3.16
131 132 2.971901 TGCCCTATACGAGATCCTCA 57.028 50.000 0.00 0.00 0.00 3.86
417 422 5.761234 ACACGTGTGACCAAATAGTACAAAT 59.239 36.000 22.71 0.00 0.00 2.32
747 786 4.016444 GCTTCCTCATTGTGGTTTCCATA 58.984 43.478 4.76 0.00 35.28 2.74
862 907 3.296854 GGGGAAAGAAAACTCCTGTGTT 58.703 45.455 0.00 0.00 31.88 3.32
1219 1286 1.453745 GCAAATCGGAGATGGCCCA 60.454 57.895 0.00 0.00 45.12 5.36
1443 1513 0.599204 CGTACGGGCACACTTTCTGT 60.599 55.000 7.57 0.00 0.00 3.41
1782 1855 0.251297 CCATGTCCTCCTTGCCACAA 60.251 55.000 0.00 0.00 0.00 3.33
1875 1948 1.241315 GGTACATTGGCGGCACTGTT 61.241 55.000 33.77 20.32 0.00 3.16
1951 2033 1.847088 GGACCAAGGGGAGAGCTTATT 59.153 52.381 0.00 0.00 38.05 1.40
2004 2092 1.115467 TGCACCGTTTGTTTCCCATT 58.885 45.000 0.00 0.00 0.00 3.16
2094 2192 7.961351 ACCCAACAATGACATTAAAGATGAAA 58.039 30.769 0.00 0.00 0.00 2.69
2165 2263 6.409524 ACAAAGGAAGAAGATGCATTTCAA 57.590 33.333 17.89 0.00 0.00 2.69
2766 2931 2.029649 TCTAAAAGTCGGGAGTTGTCCG 60.030 50.000 0.00 0.00 45.05 4.79
2879 3047 3.243501 GCACAAAATCAAGAGAGGCAACA 60.244 43.478 0.00 0.00 41.41 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.