Multiple sequence alignment - TraesCS3B01G055000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G055000 chr3B 100.000 3089 0 0 1 3089 28457101 28454013 0.000000e+00 5705
1 TraesCS3B01G055000 chr3B 99.158 3089 25 1 1 3089 28410589 28407502 0.000000e+00 5559
2 TraesCS3B01G055000 chr3B 98.835 3090 34 2 1 3089 28423754 28420666 0.000000e+00 5505
3 TraesCS3B01G055000 chr3B 96.893 3090 89 3 1 3089 28531172 28528089 0.000000e+00 5168
4 TraesCS3B01G055000 chr3B 96.732 3091 90 7 1 3089 28519763 28516682 0.000000e+00 5138
5 TraesCS3B01G055000 chr3B 95.779 2748 93 10 356 3089 28564194 28561456 0.000000e+00 4412
6 TraesCS3B01G055000 chr3B 91.595 2891 174 27 253 3087 14024363 14021486 0.000000e+00 3928
7 TraesCS3B01G055000 chr3B 92.302 2780 171 14 253 3002 14066606 14063840 0.000000e+00 3908
8 TraesCS3B01G055000 chr3B 97.392 2262 56 2 828 3089 28492700 28490442 0.000000e+00 3847
9 TraesCS3B01G055000 chr3B 96.563 611 17 2 2479 3089 28468132 28467526 0.000000e+00 1009
10 TraesCS3B01G055000 chr3B 96.800 250 7 1 1 249 28396318 28396069 1.710000e-112 416
11 TraesCS3B01G055000 chr3B 96.800 250 7 1 1 249 28442223 28441974 1.710000e-112 416
12 TraesCS3B01G055000 chrUn 96.058 2486 84 9 603 3083 307487399 307489875 0.000000e+00 4036
13 TraesCS3B01G055000 chrUn 95.977 2486 86 9 603 3083 328827719 328830195 0.000000e+00 4024
14 TraesCS3B01G055000 chrUn 97.561 246 6 0 356 601 37979290 37979045 3.680000e-114 422
15 TraesCS3B01G055000 chr3D 84.258 2903 320 50 253 3089 9949189 9946358 0.000000e+00 2702
16 TraesCS3B01G055000 chr3D 85.570 596 70 13 253 841 5682515 5681929 7.320000e-171 610
17 TraesCS3B01G055000 chr2A 83.632 2010 248 26 1134 3089 19663181 19661199 0.000000e+00 1814
18 TraesCS3B01G055000 chr2A 86.346 791 88 12 282 1070 19663944 19663172 0.000000e+00 845
19 TraesCS3B01G055000 chr7D 94.400 250 13 1 1 249 361896429 361896180 1.740000e-102 383
20 TraesCS3B01G055000 chr7B 94.400 250 13 1 1 249 388076987 388077236 1.740000e-102 383
21 TraesCS3B01G055000 chr7B 94.715 246 11 2 5 249 125939069 125938825 6.250000e-102 381


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G055000 chr3B 28454013 28457101 3088 True 5705.0 5705 100.000 1 3089 1 chr3B.!!$R7 3088
1 TraesCS3B01G055000 chr3B 28407502 28410589 3087 True 5559.0 5559 99.158 1 3089 1 chr3B.!!$R4 3088
2 TraesCS3B01G055000 chr3B 28420666 28423754 3088 True 5505.0 5505 98.835 1 3089 1 chr3B.!!$R5 3088
3 TraesCS3B01G055000 chr3B 28528089 28531172 3083 True 5168.0 5168 96.893 1 3089 1 chr3B.!!$R11 3088
4 TraesCS3B01G055000 chr3B 28516682 28519763 3081 True 5138.0 5138 96.732 1 3089 1 chr3B.!!$R10 3088
5 TraesCS3B01G055000 chr3B 28561456 28564194 2738 True 4412.0 4412 95.779 356 3089 1 chr3B.!!$R12 2733
6 TraesCS3B01G055000 chr3B 14021486 14024363 2877 True 3928.0 3928 91.595 253 3087 1 chr3B.!!$R1 2834
7 TraesCS3B01G055000 chr3B 14063840 14066606 2766 True 3908.0 3908 92.302 253 3002 1 chr3B.!!$R2 2749
8 TraesCS3B01G055000 chr3B 28490442 28492700 2258 True 3847.0 3847 97.392 828 3089 1 chr3B.!!$R9 2261
9 TraesCS3B01G055000 chr3B 28467526 28468132 606 True 1009.0 1009 96.563 2479 3089 1 chr3B.!!$R8 610
10 TraesCS3B01G055000 chrUn 307487399 307489875 2476 False 4036.0 4036 96.058 603 3083 1 chrUn.!!$F1 2480
11 TraesCS3B01G055000 chrUn 328827719 328830195 2476 False 4024.0 4024 95.977 603 3083 1 chrUn.!!$F2 2480
12 TraesCS3B01G055000 chr3D 9946358 9949189 2831 True 2702.0 2702 84.258 253 3089 1 chr3D.!!$R2 2836
13 TraesCS3B01G055000 chr3D 5681929 5682515 586 True 610.0 610 85.570 253 841 1 chr3D.!!$R1 588
14 TraesCS3B01G055000 chr2A 19661199 19663944 2745 True 1329.5 1814 84.989 282 3089 2 chr2A.!!$R1 2807

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
214 216 3.561310 CGTGCATGATTTGGCTAGTATGT 59.439 43.478 0.0 0.0 0.0 2.29 F
1240 1289 4.667935 TCCCCTTCAAGCCCCCGA 62.668 66.667 0.0 0.0 0.0 5.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1271 1324 0.179073 CGGCACCAATCGAGGAAGAT 60.179 55.0 0.0 0.0 0.0 2.40 R
2498 2642 5.483231 TGAGAGAAGATTCATCAGGAGTTGT 59.517 40.0 0.0 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 216 3.561310 CGTGCATGATTTGGCTAGTATGT 59.439 43.478 0.00 0.0 0.00 2.29
1240 1289 4.667935 TCCCCTTCAAGCCCCCGA 62.668 66.667 0.00 0.0 0.00 5.14
1271 1324 7.730784 CCAGGTTCCTCTATCTATTTCCTTCTA 59.269 40.741 0.00 0.0 0.00 2.10
1346 1414 3.496692 CCCATCTCCGATTTTCATGCCTA 60.497 47.826 0.00 0.0 0.00 3.93
1997 2068 1.673993 CAGTGCCGCCAATGTACCA 60.674 57.895 0.00 0.0 32.68 3.25
2498 2642 6.226052 CAGCATAGAGAGTATAACCATGCAA 58.774 40.000 6.44 0.0 39.72 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 102 3.319198 GACCAGACCCCTTCGCCA 61.319 66.667 0.00 0.00 0.00 5.69
214 216 1.621814 CCTCGTGGTAAGTTTCTCCCA 59.378 52.381 0.00 0.00 0.00 4.37
1240 1289 7.236640 GGAAATAGATAGAGGAACCTGGAAGAT 59.763 40.741 0.00 0.00 34.07 2.40
1271 1324 0.179073 CGGCACCAATCGAGGAAGAT 60.179 55.000 0.00 0.00 0.00 2.40
1346 1414 2.338015 CCCGCTTTGCACTGCAGAT 61.338 57.895 23.35 1.19 40.61 2.90
1559 1627 4.058732 ACCGACATGGCGCGTACA 62.059 61.111 17.71 8.19 43.94 2.90
2498 2642 5.483231 TGAGAGAAGATTCATCAGGAGTTGT 59.517 40.000 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.