Multiple sequence alignment - TraesCS3B01G051800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G051800 chr3B 100.000 3008 0 0 1 3008 26384626 26387633 0.000000e+00 5555
1 TraesCS3B01G051800 chr3B 98.771 3010 30 3 1 3008 25905977 25908981 0.000000e+00 5347
2 TraesCS3B01G051800 chr3B 98.659 2908 37 1 103 3008 25869580 25872487 0.000000e+00 5153
3 TraesCS3B01G051800 chr3B 99.006 2817 28 0 192 3008 26231600 26234416 0.000000e+00 5048
4 TraesCS3B01G051800 chr3B 99.003 2809 27 1 200 3008 26042632 26045439 0.000000e+00 5031
5 TraesCS3B01G051800 chr3B 98.655 2826 38 0 183 3008 26341205 26344030 0.000000e+00 5009
6 TraesCS3B01G051800 chr3B 98.572 2802 40 0 207 3008 26002734 26005535 0.000000e+00 4953
7 TraesCS3B01G051800 chr3B 98.015 2569 29 1 440 3008 26190566 26193112 0.000000e+00 4442
8 TraesCS3B01G051800 chr3B 98.548 1515 22 0 184 1698 26300470 26301984 0.000000e+00 2676
9 TraesCS3B01G051800 chr3B 93.542 1564 94 4 922 2482 26409715 26411274 0.000000e+00 2322
10 TraesCS3B01G051800 chr3B 81.465 2034 280 54 18 2021 15173491 15171525 0.000000e+00 1578
11 TraesCS3B01G051800 chr3B 90.993 544 36 8 2476 3008 26420083 26420624 0.000000e+00 721
12 TraesCS3B01G051800 chr3B 97.361 379 5 2 1 377 26190194 26190569 9.090000e-180 640
13 TraesCS3B01G051800 chr3B 92.754 414 14 7 1 413 26072470 26072868 4.320000e-163 584
14 TraesCS3B01G051800 chr3B 92.289 415 14 8 1 413 25936341 25936739 9.350000e-160 573
15 TraesCS3B01G051800 chr3B 89.074 421 44 1 500 918 15179038 15178618 3.440000e-144 521
16 TraesCS3B01G051800 chr3B 97.452 157 2 1 1 155 26002403 26002559 1.780000e-67 267
17 TraesCS3B01G051800 chr3B 97.452 157 2 1 1 155 26189971 26190127 1.780000e-67 267
18 TraesCS3B01G051800 chr3B 97.973 148 2 1 1 147 26300077 26300224 3.850000e-64 255
19 TraesCS3B01G051800 chr3B 98.540 137 1 1 1 136 26231402 26231538 1.080000e-59 241
20 TraesCS3B01G051800 chr3A 94.070 2091 88 5 426 2515 17432793 17434848 0.000000e+00 3142
21 TraesCS3B01G051800 chr3D 93.961 861 40 3 2159 3008 10897670 10896811 0.000000e+00 1291
22 TraesCS3B01G051800 chr3D 89.006 473 33 7 10 481 10899272 10898818 4.350000e-158 568


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G051800 chr3B 26384626 26387633 3007 False 5555.0 5555 100.000000 1 3008 1 chr3B.!!$F7 3007
1 TraesCS3B01G051800 chr3B 25905977 25908981 3004 False 5347.0 5347 98.771000 1 3008 1 chr3B.!!$F2 3007
2 TraesCS3B01G051800 chr3B 25869580 25872487 2907 False 5153.0 5153 98.659000 103 3008 1 chr3B.!!$F1 2905
3 TraesCS3B01G051800 chr3B 26042632 26045439 2807 False 5031.0 5031 99.003000 200 3008 1 chr3B.!!$F4 2808
4 TraesCS3B01G051800 chr3B 26341205 26344030 2825 False 5009.0 5009 98.655000 183 3008 1 chr3B.!!$F6 2825
5 TraesCS3B01G051800 chr3B 26231402 26234416 3014 False 2644.5 5048 98.773000 1 3008 2 chr3B.!!$F12 3007
6 TraesCS3B01G051800 chr3B 26002403 26005535 3132 False 2610.0 4953 98.012000 1 3008 2 chr3B.!!$F10 3007
7 TraesCS3B01G051800 chr3B 26409715 26411274 1559 False 2322.0 2322 93.542000 922 2482 1 chr3B.!!$F8 1560
8 TraesCS3B01G051800 chr3B 26189971 26193112 3141 False 1783.0 4442 97.609333 1 3008 3 chr3B.!!$F11 3007
9 TraesCS3B01G051800 chr3B 15171525 15173491 1966 True 1578.0 1578 81.465000 18 2021 1 chr3B.!!$R1 2003
10 TraesCS3B01G051800 chr3B 26300077 26301984 1907 False 1465.5 2676 98.260500 1 1698 2 chr3B.!!$F13 1697
11 TraesCS3B01G051800 chr3B 26420083 26420624 541 False 721.0 721 90.993000 2476 3008 1 chr3B.!!$F9 532
12 TraesCS3B01G051800 chr3A 17432793 17434848 2055 False 3142.0 3142 94.070000 426 2515 1 chr3A.!!$F1 2089
13 TraesCS3B01G051800 chr3D 10896811 10899272 2461 True 929.5 1291 91.483500 10 3008 2 chr3D.!!$R1 2998

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
706 1001 0.613777 GATTCAAGGGACGGGTCTGT 59.386 55.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2389 2707 6.873997 AGTCATGTTATTCATAACCAGACGA 58.126 36.0 17.26 4.21 43.31 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 3.657015 TGAACACCGTACACCGATAAA 57.343 42.857 0.00 0.00 39.56 1.40
208 433 2.717485 GATACGTGACGGCGCCTA 59.283 61.111 26.68 9.32 34.88 3.93
706 1001 0.613777 GATTCAAGGGACGGGTCTGT 59.386 55.000 0.00 0.00 0.00 3.41
1766 2084 4.091365 TCACGAGTATTTCAATCTTGTGCG 59.909 41.667 0.00 0.00 41.01 5.34
2051 2369 4.328536 TGGATTTGTGGTAATTACGCTGT 58.671 39.130 9.46 0.00 0.00 4.40
2389 2707 3.317993 GTGCCAACAATGTGTTCTAAGGT 59.682 43.478 0.00 0.00 38.77 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
649 944 1.211457 GTCCTGCATCTGGTCCTCAAT 59.789 52.381 0.00 0.00 0.00 2.57
2051 2369 9.973450 ACACAATTACACAACTTGCATTTTATA 57.027 25.926 0.00 0.00 0.00 0.98
2389 2707 6.873997 AGTCATGTTATTCATAACCAGACGA 58.126 36.000 17.26 4.21 43.31 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.