Multiple sequence alignment - TraesCS3B01G051300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G051300 chr3B 100.000 2992 0 0 1 2992 26056280 26059271 0.000000e+00 5526.0
1 TraesCS3B01G051300 chr3B 99.532 2992 14 0 1 2992 26398447 26401438 0.000000e+00 5448.0
2 TraesCS3B01G051300 chr3B 98.931 2993 19 4 1 2992 25920167 25923147 0.000000e+00 5337.0
3 TraesCS3B01G051300 chr3B 97.264 2997 69 6 1 2992 26429104 26432092 0.000000e+00 5068.0
4 TraesCS3B01G051300 chr3B 98.774 2283 18 2 1 2283 26245278 26247550 0.000000e+00 4052.0
5 TraesCS3B01G051300 chr3B 90.586 2985 224 28 29 2986 15168062 15165108 0.000000e+00 3903.0
6 TraesCS3B01G051300 chr3B 84.605 2832 346 42 33 2816 15096528 15099317 0.000000e+00 2732.0
7 TraesCS3B01G051300 chr3B 84.534 2832 349 42 33 2816 15142655 15139865 0.000000e+00 2721.0
8 TraesCS3B01G051300 chr3B 97.497 759 3 4 2249 2992 26247583 26248340 0.000000e+00 1282.0
9 TraesCS3B01G051300 chr3B 86.211 834 99 11 110 934 15164996 15164170 0.000000e+00 889.0
10 TraesCS3B01G051300 chr3B 85.000 760 98 11 106 857 26432194 26432945 0.000000e+00 758.0
11 TraesCS3B01G051300 chr3D 86.789 2233 242 23 29 2246 10803142 10805336 0.000000e+00 2440.0
12 TraesCS3B01G051300 chr3D 84.797 1776 226 21 1062 2805 10807437 10809200 0.000000e+00 1744.0
13 TraesCS3B01G051300 chr3D 84.273 1774 235 18 1062 2805 10820764 10822523 0.000000e+00 1690.0
14 TraesCS3B01G051300 chr1D 90.595 1680 140 14 1 1672 447664697 447666366 0.000000e+00 2211.0
15 TraesCS3B01G051300 chr3A 83.669 1788 221 38 1062 2816 17449591 17447842 0.000000e+00 1618.0
16 TraesCS3B01G051300 chr3A 88.462 78 8 1 80 156 17508170 17508093 3.180000e-15 93.5
17 TraesCS3B01G051300 chrUn 85.375 253 32 3 2557 2805 335935963 335936214 1.060000e-64 257.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G051300 chr3B 26056280 26059271 2991 False 5526 5526 100.0000 1 2992 1 chr3B.!!$F3 2991
1 TraesCS3B01G051300 chr3B 26398447 26401438 2991 False 5448 5448 99.5320 1 2992 1 chr3B.!!$F4 2991
2 TraesCS3B01G051300 chr3B 25920167 25923147 2980 False 5337 5337 98.9310 1 2992 1 chr3B.!!$F2 2991
3 TraesCS3B01G051300 chr3B 26429104 26432945 3841 False 2913 5068 91.1320 1 2992 2 chr3B.!!$F6 2991
4 TraesCS3B01G051300 chr3B 15096528 15099317 2789 False 2732 2732 84.6050 33 2816 1 chr3B.!!$F1 2783
5 TraesCS3B01G051300 chr3B 15139865 15142655 2790 True 2721 2721 84.5340 33 2816 1 chr3B.!!$R1 2783
6 TraesCS3B01G051300 chr3B 26245278 26248340 3062 False 2667 4052 98.1355 1 2992 2 chr3B.!!$F5 2991
7 TraesCS3B01G051300 chr3B 15164170 15168062 3892 True 2396 3903 88.3985 29 2986 2 chr3B.!!$R2 2957
8 TraesCS3B01G051300 chr3D 10803142 10809200 6058 False 2092 2440 85.7930 29 2805 2 chr3D.!!$F2 2776
9 TraesCS3B01G051300 chr3D 10820764 10822523 1759 False 1690 1690 84.2730 1062 2805 1 chr3D.!!$F1 1743
10 TraesCS3B01G051300 chr1D 447664697 447666366 1669 False 2211 2211 90.5950 1 1672 1 chr1D.!!$F1 1671
11 TraesCS3B01G051300 chr3A 17447842 17449591 1749 True 1618 1618 83.6690 1062 2816 1 chr3A.!!$R1 1754

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
43 44 3.432933 GCGAGGGAAACGTAAATTACACA 59.567 43.478 3.91 0.0 0.0 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2033 5365 9.593134 TTATGCAACCAATTATTACAAATCCAC 57.407 29.63 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 3.432933 GCGAGGGAAACGTAAATTACACA 59.567 43.478 3.91 0.0 0.00 3.72
144 150 5.770162 AGAGGGGTCATTTTCAAACACTAAG 59.230 40.000 0.00 0.0 0.00 2.18
2033 5365 8.078060 ACCAATTAATTTATCAGGGAAAGTGG 57.922 34.615 0.00 0.0 0.00 4.00
2166 5498 9.036671 TGTGTAATTCATATGGTGTACATAACG 57.963 33.333 0.00 0.0 44.75 3.18
2396 5812 4.207955 GGTCTGGAAAAAGAAAGTGACCT 58.792 43.478 0.00 0.0 39.47 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 5.946942 TGGAGATCACAAAGAGAGCTAAT 57.053 39.13 0.0 0.0 30.84 1.73
298 306 6.442513 AATGAGATACTAAAAAGTGCCTGC 57.557 37.50 0.0 0.0 0.00 4.85
2033 5365 9.593134 TTATGCAACCAATTATTACAAATCCAC 57.407 29.63 0.0 0.0 0.00 4.02
2396 5812 8.966868 ACTTCTTTTAAACCATCAAAGACAAGA 58.033 29.63 0.0 0.0 36.49 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.