Multiple sequence alignment - TraesCS3B01G051000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G051000 chr3B 100.000 3152 0 0 1 3152 25905879 25909030 0.000000e+00 5821
1 TraesCS3B01G051000 chr3B 98.765 3157 32 3 1 3152 26384528 26387682 0.000000e+00 5607
2 TraesCS3B01G051000 chr3B 99.440 2857 16 0 296 3152 26042632 26045488 0.000000e+00 5188
3 TraesCS3B01G051000 chr3B 98.275 2957 44 3 203 3152 25869580 25872536 0.000000e+00 5171
4 TraesCS3B01G051000 chr3B 98.883 2866 31 1 288 3152 26231600 26234465 0.000000e+00 5114
5 TraesCS3B01G051000 chr3B 98.470 2875 43 1 279 3152 26341205 26344079 0.000000e+00 5064
6 TraesCS3B01G051000 chr3B 98.387 2851 45 1 303 3152 26002734 26005584 0.000000e+00 5009
7 TraesCS3B01G051000 chr3B 97.823 2618 35 1 535 3152 26190566 26193161 0.000000e+00 4499
8 TraesCS3B01G051000 chr3B 98.350 1515 24 1 280 1793 26300470 26301984 0.000000e+00 2658
9 TraesCS3B01G051000 chr3B 93.350 1564 97 4 1017 2577 26409715 26411274 0.000000e+00 2305
10 TraesCS3B01G051000 chr3B 81.796 2027 278 49 119 2116 15173489 15171525 0.000000e+00 1615
11 TraesCS3B01G051000 chr3B 91.216 592 39 8 2571 3151 26420083 26420672 0.000000e+00 793
12 TraesCS3B01G051000 chr3B 94.314 510 14 8 1 508 25936243 25936739 0.000000e+00 767
13 TraesCS3B01G051000 chr3B 93.933 511 14 9 1 508 26072372 26072868 0.000000e+00 756
14 TraesCS3B01G051000 chr3B 98.148 432 6 2 43 472 26190138 26190569 0.000000e+00 752
15 TraesCS3B01G051000 chr3B 89.311 421 43 1 595 1013 15179038 15178618 7.740000e-146 527
16 TraesCS3B01G051000 chr3B 98.431 255 4 0 1 255 26002305 26002559 1.720000e-122 449
17 TraesCS3B01G051000 chr3B 98.431 255 4 0 1 255 26189873 26190127 1.720000e-122 449
18 TraesCS3B01G051000 chr3B 99.153 236 1 1 1 236 26231304 26231538 1.050000e-114 424
19 TraesCS3B01G051000 chr3B 96.761 247 7 1 1 247 26299979 26300224 8.140000e-111 411
20 TraesCS3B01G051000 chr3B 97.585 207 4 1 1 207 26340654 26340859 1.390000e-93 353
21 TraesCS3B01G051000 chr3A 93.974 2091 90 4 521 2610 17432793 17434848 0.000000e+00 3131
22 TraesCS3B01G051000 chr3D 93.626 910 46 3 2254 3152 10897670 10896762 0.000000e+00 1349


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G051000 chr3B 25905879 25909030 3151 False 5821.0 5821 100.0000 1 3152 1 chr3B.!!$F2 3151
1 TraesCS3B01G051000 chr3B 26384528 26387682 3154 False 5607.0 5607 98.7650 1 3152 1 chr3B.!!$F6 3151
2 TraesCS3B01G051000 chr3B 26042632 26045488 2856 False 5188.0 5188 99.4400 296 3152 1 chr3B.!!$F4 2856
3 TraesCS3B01G051000 chr3B 25869580 25872536 2956 False 5171.0 5171 98.2750 203 3152 1 chr3B.!!$F1 2949
4 TraesCS3B01G051000 chr3B 26231304 26234465 3161 False 2769.0 5114 99.0180 1 3152 2 chr3B.!!$F11 3151
5 TraesCS3B01G051000 chr3B 26002305 26005584 3279 False 2729.0 5009 98.4090 1 3152 2 chr3B.!!$F9 3151
6 TraesCS3B01G051000 chr3B 26340654 26344079 3425 False 2708.5 5064 98.0275 1 3152 2 chr3B.!!$F13 3151
7 TraesCS3B01G051000 chr3B 26409715 26411274 1559 False 2305.0 2305 93.3500 1017 2577 1 chr3B.!!$F7 1560
8 TraesCS3B01G051000 chr3B 26189873 26193161 3288 False 1900.0 4499 98.1340 1 3152 3 chr3B.!!$F10 3151
9 TraesCS3B01G051000 chr3B 15171525 15173489 1964 True 1615.0 1615 81.7960 119 2116 1 chr3B.!!$R1 1997
10 TraesCS3B01G051000 chr3B 26299979 26301984 2005 False 1534.5 2658 97.5555 1 1793 2 chr3B.!!$F12 1792
11 TraesCS3B01G051000 chr3B 26420083 26420672 589 False 793.0 793 91.2160 2571 3151 1 chr3B.!!$F8 580
12 TraesCS3B01G051000 chr3A 17432793 17434848 2055 False 3131.0 3131 93.9740 521 2610 1 chr3A.!!$F1 2089
13 TraesCS3B01G051000 chr3D 10896762 10897670 908 True 1349.0 1349 93.6260 2254 3152 1 chr3D.!!$R1 898

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
947 1465 2.540157 CCAGCGACATACGTACGAATCA 60.54 50.0 24.41 4.14 44.6 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2707 3244 3.117131 AGAACAAACAGATTGGGGAGGTT 60.117 43.478 0.0 0.0 43.66 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
690 1203 2.560981 TCTGTCGATGTGCCTTACTGAA 59.439 45.455 0.00 0.00 0.00 3.02
947 1465 2.540157 CCAGCGACATACGTACGAATCA 60.540 50.000 24.41 4.14 44.60 2.57
2366 2893 6.398918 ACTCACGCTTATAAGAAAGACACAT 58.601 36.000 16.85 0.00 0.00 3.21
2486 3013 2.890311 CCAACAATGTGTTCTAAGGGCA 59.110 45.455 0.00 0.00 38.77 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 371 9.956720 ATTTGTTTCATTTTTGACAAAACACAA 57.043 22.222 12.86 12.82 42.93 3.33
947 1465 2.543777 ACATAGTGTTCACTGCGGTT 57.456 45.000 14.69 0.00 0.00 4.44
2707 3244 3.117131 AGAACAAACAGATTGGGGAGGTT 60.117 43.478 0.00 0.00 43.66 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.