Multiple sequence alignment - TraesCS3B01G040700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G040700 chr3B 100.000 2549 0 0 1 2549 20304516 20307064 0.000000e+00 4708
1 TraesCS3B01G040700 chr3B 99.141 1978 16 1 572 2549 702857655 702855679 0.000000e+00 3557
2 TraesCS3B01G040700 chr3B 98.429 573 8 1 1 572 13718341 13717769 0.000000e+00 1007
3 TraesCS3B01G040700 chr3B 98.429 573 8 1 1 572 59985201 59985773 0.000000e+00 1007
4 TraesCS3B01G040700 chr3B 98.429 573 8 1 1 572 825791393 825790821 0.000000e+00 1007
5 TraesCS3B01G040700 chr2B 99.194 1986 14 2 566 2549 776222953 776224938 0.000000e+00 3578
6 TraesCS3B01G040700 chr2B 99.191 1978 16 0 572 2549 781094240 781096217 0.000000e+00 3565
7 TraesCS3B01G040700 chr3A 99.094 1986 17 1 564 2549 54951909 54953893 0.000000e+00 3567
8 TraesCS3B01G040700 chr7A 99.141 1979 17 0 571 2549 39015366 39017344 0.000000e+00 3561
9 TraesCS3B01G040700 chr7A 99.090 1978 18 0 572 2549 332474954 332472977 0.000000e+00 3554
10 TraesCS3B01G040700 chr4B 99.141 1979 15 2 572 2549 368430368 368428391 0.000000e+00 3559
11 TraesCS3B01G040700 chr4B 98.953 573 5 1 1 572 1894485 1893913 0.000000e+00 1024
12 TraesCS3B01G040700 chr4B 98.953 573 5 1 1 572 670196170 670196742 0.000000e+00 1024
13 TraesCS3B01G040700 chr5B 99.091 1980 17 1 571 2549 641128781 641126802 0.000000e+00 3555
14 TraesCS3B01G040700 chr5B 99.302 573 3 1 1 572 645050655 645051227 0.000000e+00 1035
15 TraesCS3B01G040700 chr6A 99.090 1979 16 2 572 2549 616131295 616133272 0.000000e+00 3554
16 TraesCS3B01G040700 chr6B 98.604 573 7 1 1 572 32007343 32007915 0.000000e+00 1013
17 TraesCS3B01G040700 chr6B 98.429 573 8 1 1 572 30335038 30335610 0.000000e+00 1007
18 TraesCS3B01G040700 chr1B 98.429 573 8 1 1 572 162175076 162175648 0.000000e+00 1007
19 TraesCS3B01G040700 chr4A 92.050 239 6 11 424 658 616399391 616399162 8.800000e-85 324


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G040700 chr3B 20304516 20307064 2548 False 4708 4708 100.000 1 2549 1 chr3B.!!$F1 2548
1 TraesCS3B01G040700 chr3B 702855679 702857655 1976 True 3557 3557 99.141 572 2549 1 chr3B.!!$R2 1977
2 TraesCS3B01G040700 chr3B 13717769 13718341 572 True 1007 1007 98.429 1 572 1 chr3B.!!$R1 571
3 TraesCS3B01G040700 chr3B 59985201 59985773 572 False 1007 1007 98.429 1 572 1 chr3B.!!$F2 571
4 TraesCS3B01G040700 chr3B 825790821 825791393 572 True 1007 1007 98.429 1 572 1 chr3B.!!$R3 571
5 TraesCS3B01G040700 chr2B 776222953 776224938 1985 False 3578 3578 99.194 566 2549 1 chr2B.!!$F1 1983
6 TraesCS3B01G040700 chr2B 781094240 781096217 1977 False 3565 3565 99.191 572 2549 1 chr2B.!!$F2 1977
7 TraesCS3B01G040700 chr3A 54951909 54953893 1984 False 3567 3567 99.094 564 2549 1 chr3A.!!$F1 1985
8 TraesCS3B01G040700 chr7A 39015366 39017344 1978 False 3561 3561 99.141 571 2549 1 chr7A.!!$F1 1978
9 TraesCS3B01G040700 chr7A 332472977 332474954 1977 True 3554 3554 99.090 572 2549 1 chr7A.!!$R1 1977
10 TraesCS3B01G040700 chr4B 368428391 368430368 1977 True 3559 3559 99.141 572 2549 1 chr4B.!!$R2 1977
11 TraesCS3B01G040700 chr4B 1893913 1894485 572 True 1024 1024 98.953 1 572 1 chr4B.!!$R1 571
12 TraesCS3B01G040700 chr4B 670196170 670196742 572 False 1024 1024 98.953 1 572 1 chr4B.!!$F1 571
13 TraesCS3B01G040700 chr5B 641126802 641128781 1979 True 3555 3555 99.091 571 2549 1 chr5B.!!$R1 1978
14 TraesCS3B01G040700 chr5B 645050655 645051227 572 False 1035 1035 99.302 1 572 1 chr5B.!!$F1 571
15 TraesCS3B01G040700 chr6A 616131295 616133272 1977 False 3554 3554 99.090 572 2549 1 chr6A.!!$F1 1977
16 TraesCS3B01G040700 chr6B 32007343 32007915 572 False 1013 1013 98.604 1 572 1 chr6B.!!$F2 571
17 TraesCS3B01G040700 chr6B 30335038 30335610 572 False 1007 1007 98.429 1 572 1 chr6B.!!$F1 571
18 TraesCS3B01G040700 chr1B 162175076 162175648 572 False 1007 1007 98.429 1 572 1 chr1B.!!$F1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
658 660 1.003696 GCTCAGTTTTGCCCCTAGTCT 59.996 52.381 0.0 0.0 0.0 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2330 2333 6.340522 CAAAACAAAGGAAAACCACTCTCAT 58.659 36.0 0.0 0.0 0.0 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
658 660 1.003696 GCTCAGTTTTGCCCCTAGTCT 59.996 52.381 0.00 0.0 0.00 3.24
776 778 2.157834 TTATTCAGACCGTTGCACGT 57.842 45.000 7.68 0.0 40.58 4.49
1083 1085 3.553437 CTTCGTCTGTCCGCGGTGT 62.553 63.158 27.15 0.0 0.00 4.16
1119 1121 1.070134 CGAAGGGTTTCTCAGACACCA 59.930 52.381 12.23 0.0 34.39 4.17
1267 1269 4.280436 TGCTTCTTTCTTTGGGTCGATA 57.720 40.909 0.00 0.0 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
658 660 4.578898 AACGAGTCGGTGCGCACA 62.579 61.111 38.60 19.65 0.00 4.57
776 778 3.099841 TGGGTCCCACAAGCCACA 61.100 61.111 6.47 0.00 41.74 4.17
1119 1121 0.974383 ACGGACGATTCTGGTTCCTT 59.026 50.000 0.00 0.00 31.53 3.36
1267 1269 1.554160 CATCAGAGTCTTGGCCAGAGT 59.446 52.381 5.11 8.92 37.96 3.24
1932 1934 7.531857 TTCTAACATTAATTGTTTGGCTCCA 57.468 32.000 8.06 0.00 46.51 3.86
2330 2333 6.340522 CAAAACAAAGGAAAACCACTCTCAT 58.659 36.000 0.00 0.00 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.