Multiple sequence alignment - TraesCS3B01G033900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G033900 chr3B 100.000 2289 0 0 1 2289 16181376 16179088 0.000000e+00 4228
1 TraesCS3B01G033900 chr3B 97.015 469 14 0 1821 2289 280586113 280586581 0.000000e+00 789
2 TraesCS3B01G033900 chr3B 96.802 469 15 0 1821 2289 734369397 734369865 0.000000e+00 784
3 TraesCS3B01G033900 chr3B 96.783 373 9 1 1436 1805 280585649 280586021 8.980000e-174 619
4 TraesCS3B01G033900 chr6B 94.765 2254 101 10 40 2289 387720728 387718488 0.000000e+00 3493
5 TraesCS3B01G033900 chr6B 95.212 898 42 1 340 1237 160387952 160388848 0.000000e+00 1419
6 TraesCS3B01G033900 chr6B 96.477 369 10 1 1440 1805 464409822 464410190 6.990000e-170 606
7 TraesCS3B01G033900 chr6B 96.599 147 5 0 1 147 160387430 160387576 6.320000e-61 244
8 TraesCS3B01G033900 chr4B 96.177 1805 66 3 1 1804 565111027 565112829 0.000000e+00 2948
9 TraesCS3B01G033900 chr4B 95.803 953 39 1 285 1237 10622604 10621653 0.000000e+00 1537
10 TraesCS3B01G033900 chr4B 96.049 734 24 3 662 1394 273688036 273688765 0.000000e+00 1190
11 TraesCS3B01G033900 chr4B 98.721 469 6 0 1821 2289 548861699 548861231 0.000000e+00 833
12 TraesCS3B01G033900 chr4B 97.340 376 7 1 1436 1808 548862163 548861788 8.920000e-179 636
13 TraesCS3B01G033900 chr4B 95.848 289 12 0 1 289 10651511 10651223 3.440000e-128 468
14 TraesCS3B01G033900 chr7B 95.900 1805 72 2 2 1805 709128018 709129821 0.000000e+00 2922
15 TraesCS3B01G033900 chr7B 95.935 1722 67 3 88 1808 613376213 613374494 0.000000e+00 2789
16 TraesCS3B01G033900 chr7B 96.822 818 25 1 420 1237 718399559 718400375 0.000000e+00 1365
17 TraesCS3B01G033900 chr7B 99.360 469 3 0 1821 2289 709129913 709130381 0.000000e+00 850
18 TraesCS3B01G033900 chr7B 98.721 469 6 0 1821 2289 613374405 613373937 0.000000e+00 833
19 TraesCS3B01G033900 chr7B 98.498 466 7 0 1821 2286 616913757 616914222 0.000000e+00 822
20 TraesCS3B01G033900 chr7B 97.568 370 9 0 1436 1805 616913293 616913662 3.210000e-178 634
21 TraesCS3B01G033900 chr7B 95.288 191 9 0 1 191 718398956 718399146 1.030000e-78 303
22 TraesCS3B01G033900 chr2B 96.146 1505 55 3 305 1808 29006471 29004969 0.000000e+00 2455
23 TraesCS3B01G033900 chr2B 98.721 469 6 0 1821 2289 29004880 29004412 0.000000e+00 833
24 TraesCS3B01G033900 chr2B 94.677 263 14 0 1 263 29007123 29006861 2.120000e-110 409
25 TraesCS3B01G033900 chr7D 97.222 468 12 1 1823 2289 609065214 609064747 0.000000e+00 791
26 TraesCS3B01G033900 chr7D 95.122 246 9 1 1566 1808 158645573 158645328 3.570000e-103 385
27 TraesCS3B01G033900 chr3D 91.375 371 23 4 299 663 544412424 544412791 1.220000e-137 499
28 TraesCS3B01G033900 chr5D 93.885 278 15 2 10 286 448296376 448296652 3.520000e-113 418
29 TraesCS3B01G033900 chr2A 92.857 98 7 0 119 216 749605419 749605322 2.370000e-30 143
30 TraesCS3B01G033900 chr2A 93.243 74 4 1 1 73 11482537 11482610 8.650000e-20 108
31 TraesCS3B01G033900 chr5A 94.595 74 3 1 1 73 33142971 33143044 1.860000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G033900 chr3B 16179088 16181376 2288 True 4228.000000 4228 100.000000 1 2289 1 chr3B.!!$R1 2288
1 TraesCS3B01G033900 chr3B 280585649 280586581 932 False 704.000000 789 96.899000 1436 2289 2 chr3B.!!$F2 853
2 TraesCS3B01G033900 chr6B 387718488 387720728 2240 True 3493.000000 3493 94.765000 40 2289 1 chr6B.!!$R1 2249
3 TraesCS3B01G033900 chr6B 160387430 160388848 1418 False 831.500000 1419 95.905500 1 1237 2 chr6B.!!$F2 1236
4 TraesCS3B01G033900 chr4B 565111027 565112829 1802 False 2948.000000 2948 96.177000 1 1804 1 chr4B.!!$F2 1803
5 TraesCS3B01G033900 chr4B 10621653 10622604 951 True 1537.000000 1537 95.803000 285 1237 1 chr4B.!!$R1 952
6 TraesCS3B01G033900 chr4B 273688036 273688765 729 False 1190.000000 1190 96.049000 662 1394 1 chr4B.!!$F1 732
7 TraesCS3B01G033900 chr4B 548861231 548862163 932 True 734.500000 833 98.030500 1436 2289 2 chr4B.!!$R3 853
8 TraesCS3B01G033900 chr7B 709128018 709130381 2363 False 1886.000000 2922 97.630000 2 2289 2 chr7B.!!$F2 2287
9 TraesCS3B01G033900 chr7B 613373937 613376213 2276 True 1811.000000 2789 97.328000 88 2289 2 chr7B.!!$R1 2201
10 TraesCS3B01G033900 chr7B 718398956 718400375 1419 False 834.000000 1365 96.055000 1 1237 2 chr7B.!!$F3 1236
11 TraesCS3B01G033900 chr7B 616913293 616914222 929 False 728.000000 822 98.033000 1436 2286 2 chr7B.!!$F1 850
12 TraesCS3B01G033900 chr2B 29004412 29007123 2711 True 1232.333333 2455 96.514667 1 2289 3 chr2B.!!$R1 2288

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
463 812 0.102481 GATAAGGAAGCGGCTCGACA 59.898 55.0 1.45 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1678 2033 4.154195 GGAGTAATCGAATGTGTTGCAAGT 59.846 41.667 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 1.118356 GCCCTCACATCCTCCGAGAT 61.118 60.000 0.00 0.00 0.00 2.75
156 157 3.723922 GCCCGAAACCCTAGCCCA 61.724 66.667 0.00 0.00 0.00 5.36
202 203 4.853142 ATCCGCGGGCTGGAGGTA 62.853 66.667 27.83 1.69 39.30 3.08
205 206 4.077184 CGCGGGCTGGAGGTACAA 62.077 66.667 0.00 0.00 0.00 2.41
231 232 2.708132 CCTCCCTCCCCTCCCCTA 60.708 72.222 0.00 0.00 0.00 3.53
300 301 4.052229 CGACTTCCTCCACCGCGT 62.052 66.667 4.92 0.00 0.00 6.01
463 812 0.102481 GATAAGGAAGCGGCTCGACA 59.898 55.000 1.45 0.00 0.00 4.35
496 845 4.530857 GCGCCGCCTACCACATCT 62.531 66.667 0.00 0.00 0.00 2.90
946 1297 4.274950 GCTTAGTTTGTGCCTCAACAACTA 59.725 41.667 0.00 0.00 39.70 2.24
951 1302 4.481930 TTGTGCCTCAACAACTATTTCG 57.518 40.909 0.00 0.00 35.16 3.46
986 1337 3.177884 TTGCTGTGCCACTCCCCT 61.178 61.111 0.00 0.00 0.00 4.79
1008 1359 3.142838 GCCGCCACCATGCAGAAT 61.143 61.111 0.00 0.00 0.00 2.40
1168 1519 2.525124 ATCACGGCCAAGGACCACA 61.525 57.895 2.24 0.00 0.00 4.17
1208 1559 3.676291 TGGTCACGTTGATGAGAATGA 57.324 42.857 0.00 0.00 0.00 2.57
1678 2033 3.133003 GGAGCATCTGGTTAGAGTAGCAA 59.867 47.826 0.00 0.00 36.14 3.91
2156 2590 8.783833 TTCTTATTCTTCCTCAGATTGTGAAG 57.216 34.615 0.00 0.00 33.60 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 203 3.246880 GGGAGGGTCCGGTGTTGT 61.247 66.667 0.00 0.0 37.43 3.32
205 206 4.716977 GGAGGGAGGGTCCGGTGT 62.717 72.222 0.00 0.0 37.43 4.16
447 796 1.374758 CTTGTCGAGCCGCTTCCTT 60.375 57.895 0.00 0.0 0.00 3.36
463 812 2.125106 GCGGTTGGCGGAGATCTT 60.125 61.111 0.00 0.0 0.00 2.40
560 909 1.834188 AATTTTGGGAGCGTGGGTAG 58.166 50.000 0.00 0.0 0.00 3.18
561 910 2.306512 AGTAATTTTGGGAGCGTGGGTA 59.693 45.455 0.00 0.0 0.00 3.69
813 1164 4.806640 AACAAATGGCAGGAATCGATTT 57.193 36.364 12.81 0.0 0.00 2.17
854 1205 6.108687 AGAATCTAGCGACATCATTCAACAA 58.891 36.000 0.00 0.0 0.00 2.83
946 1297 0.171007 CGACTGCAAATGGCCGAAAT 59.829 50.000 0.00 0.0 43.89 2.17
951 1302 0.031994 AACAACGACTGCAAATGGCC 59.968 50.000 0.00 0.0 43.89 5.36
986 1337 4.794648 GCATGGTGGCGGCTGGTA 62.795 66.667 11.43 0.0 0.00 3.25
1008 1359 1.760527 CACCATGTCACCCACCTCA 59.239 57.895 0.00 0.0 0.00 3.86
1168 1519 3.136077 CCAATGATGATCTGGACAGAGGT 59.864 47.826 8.14 0.0 41.33 3.85
1287 1638 5.689383 GTGACCACACACATAGTTCAATT 57.311 39.130 0.00 0.0 45.32 2.32
1400 1752 8.248945 CAGCACAATAATCAAGGAAGAAATCTT 58.751 33.333 0.00 0.0 39.23 2.40
1678 2033 4.154195 GGAGTAATCGAATGTGTTGCAAGT 59.846 41.667 0.00 0.0 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.