Multiple sequence alignment - TraesCS3B01G013500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G013500 chr3B 100.000 2471 0 0 1 2471 6005943 6003473 0 4564
1 TraesCS3B01G013500 chr3A 98.503 2472 36 1 1 2471 495099936 495097465 0 4359
2 TraesCS3B01G013500 chr2B 98.301 2472 41 1 1 2471 449214510 449212039 0 4331
3 TraesCS3B01G013500 chr2B 98.100 2474 38 3 1 2471 234536334 234533867 0 4300
4 TraesCS3B01G013500 chr1B 98.220 2472 43 1 1 2471 619190508 619188037 0 4320
5 TraesCS3B01G013500 chr6A 98.283 2446 39 1 29 2471 84404696 84402251 0 4281
6 TraesCS3B01G013500 chr1A 97.816 2472 53 1 1 2471 278526016 278528487 0 4265
7 TraesCS3B01G013500 chr6D 97.694 2472 55 2 1 2471 458923538 458921068 0 4248
8 TraesCS3B01G013500 chr7A 97.495 2475 57 3 1 2471 563517274 563514801 0 4222
9 TraesCS3B01G013500 chr3D 97.250 2473 64 4 1 2471 501833557 501831087 0 4187


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G013500 chr3B 6003473 6005943 2470 True 4564 4564 100.000 1 2471 1 chr3B.!!$R1 2470
1 TraesCS3B01G013500 chr3A 495097465 495099936 2471 True 4359 4359 98.503 1 2471 1 chr3A.!!$R1 2470
2 TraesCS3B01G013500 chr2B 449212039 449214510 2471 True 4331 4331 98.301 1 2471 1 chr2B.!!$R2 2470
3 TraesCS3B01G013500 chr2B 234533867 234536334 2467 True 4300 4300 98.100 1 2471 1 chr2B.!!$R1 2470
4 TraesCS3B01G013500 chr1B 619188037 619190508 2471 True 4320 4320 98.220 1 2471 1 chr1B.!!$R1 2470
5 TraesCS3B01G013500 chr6A 84402251 84404696 2445 True 4281 4281 98.283 29 2471 1 chr6A.!!$R1 2442
6 TraesCS3B01G013500 chr1A 278526016 278528487 2471 False 4265 4265 97.816 1 2471 1 chr1A.!!$F1 2470
7 TraesCS3B01G013500 chr6D 458921068 458923538 2470 True 4248 4248 97.694 1 2471 1 chr6D.!!$R1 2470
8 TraesCS3B01G013500 chr7A 563514801 563517274 2473 True 4222 4222 97.495 1 2471 1 chr7A.!!$R1 2470
9 TraesCS3B01G013500 chr3D 501831087 501833557 2470 True 4187 4187 97.250 1 2471 1 chr3D.!!$R1 2470

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
996 1000 4.065088 CGGATTCTTGAACCTCTTTCACA 58.935 43.478 0.0 0.0 44.28 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2393 2404 6.401047 CGTTCACAATTTCTTGAAGCTCGATA 60.401 38.462 0.0 0.0 36.2 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 7.232127 ACATTGATACCATCATTCCAATCTTCC 59.768 37.037 0.00 0.0 39.39 3.46
77 78 7.299896 TGATACCATCATTCCAATCTTCCATT 58.700 34.615 0.00 0.0 33.59 3.16
347 348 6.086871 GTGTGAGATATCGCATTATTCGAGA 58.913 40.000 12.50 0.0 39.47 4.04
404 405 4.100529 GCGTTCTAGTGCGTTGTAGATTA 58.899 43.478 9.56 0.0 0.00 1.75
568 569 7.227512 GGAACTCTTATATGTCCAAGGTCAATG 59.772 40.741 0.00 0.0 0.00 2.82
701 702 9.476202 GCACTTCTTTTTCCATTACACTATTTT 57.524 29.630 0.00 0.0 0.00 1.82
791 792 6.037940 GGAGGGAAACGGATACTCAATTTAAC 59.962 42.308 0.00 0.0 0.00 2.01
996 1000 4.065088 CGGATTCTTGAACCTCTTTCACA 58.935 43.478 0.00 0.0 44.28 3.58
1099 1103 5.697633 GTGGTTAACCGTATTCTGAAAGACA 59.302 40.000 19.65 0.0 40.70 3.41
1368 1375 9.573133 CGAAATATGGCTTTCAAATTAAGTTCT 57.427 29.630 0.00 0.0 35.32 3.01
1548 1555 9.401058 GGAAAAGAATCAATAGAAGGAGAATCA 57.599 33.333 0.00 0.0 36.25 2.57
1757 1765 3.610911 GGACTTTTCGGAGATTGGATGT 58.389 45.455 0.00 0.0 35.04 3.06
1769 1777 8.701895 TCGGAGATTGGATGTAGTTACTAATTT 58.298 33.333 0.00 0.0 0.00 1.82
1832 1840 9.988350 GATTCTACGAGAATTTTTATGAAAGCA 57.012 29.630 10.21 0.0 44.41 3.91
2021 2029 4.145807 TCCGATGGAGAGAAGAACCTATC 58.854 47.826 0.00 0.0 0.00 2.08
2159 2167 8.540388 ACAGAAATGGCTATAACAGAGTTTCTA 58.460 33.333 0.00 0.0 33.09 2.10
2370 2378 3.394274 TCTGGTTCATGGTTTCTCTTGGA 59.606 43.478 0.00 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 4.574421 TCATGGTATTTAGCACGGACAATG 59.426 41.667 0.00 0.00 36.42 2.82
77 78 3.897141 TCATGGTATTTAGCACGGACA 57.103 42.857 0.00 0.00 36.42 4.02
701 702 2.764572 GGATCGAGTCCTTAGGTTTCCA 59.235 50.000 0.00 0.00 44.16 3.53
791 792 6.020599 CGAGTATGGAATTCTGTTTACTCACG 60.021 42.308 22.46 14.30 36.80 4.35
996 1000 1.467734 GTACCTCGACGTGACATGAGT 59.532 52.381 0.00 0.00 0.00 3.41
1268 1275 9.844257 CTCTTCCTTGTTTAGATCCTATTTCAT 57.156 33.333 0.00 0.00 0.00 2.57
1368 1375 4.883585 CCTTTGGCAGCATCTACTAATTCA 59.116 41.667 0.00 0.00 0.00 2.57
1548 1555 6.866770 TGTTTGTTTCGAGAAAGATATCGTCT 59.133 34.615 10.68 10.68 40.97 4.18
1769 1777 6.423776 TCATTCTGTACATGCCAGATCATA 57.576 37.500 14.44 2.97 38.66 2.15
1832 1840 7.235935 TCCATTGAAGAGAAGCAAATGAAAT 57.764 32.000 0.00 0.00 0.00 2.17
2393 2404 6.401047 CGTTCACAATTTCTTGAAGCTCGATA 60.401 38.462 0.00 0.00 36.20 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.