Multiple sequence alignment - TraesCS3B01G013400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G013400 chr3B 100.000 2273 0 0 1 2273 6000135 6002407 0.000000e+00 4198.0
1 TraesCS3B01G013400 chr2B 99.208 2273 18 0 1 2273 449208697 449210969 0.000000e+00 4098.0
2 TraesCS3B01G013400 chr2B 98.988 2273 22 1 1 2273 234530529 234532800 0.000000e+00 4069.0
3 TraesCS3B01G013400 chr2B 96.908 938 20 2 1344 2273 474912189 474913125 0.000000e+00 1563.0
4 TraesCS3B01G013400 chr2B 97.568 658 16 0 1 658 1448925 1448268 0.000000e+00 1127.0
5 TraesCS3B01G013400 chr2B 98.697 307 3 1 569 874 357695122 357694816 5.520000e-151 544.0
6 TraesCS3B01G013400 chr2B 99.512 205 1 0 894 1098 544263800 544264004 7.670000e-100 374.0
7 TraesCS3B01G013400 chr2B 97.826 46 1 0 1344 1389 110645485 110645440 1.870000e-11 80.5
8 TraesCS3B01G013400 chr3A 99.120 2273 19 1 1 2273 495091909 495094180 0.000000e+00 4085.0
9 TraesCS3B01G013400 chr7A 98.988 2273 22 1 1 2273 60220134 60222405 0.000000e+00 4069.0
10 TraesCS3B01G013400 chr4B 98.680 2273 29 1 1 2273 495577616 495579887 0.000000e+00 4030.0
11 TraesCS3B01G013400 chr1B 98.460 2273 34 1 1 2273 619184700 619186971 0.000000e+00 4002.0
12 TraesCS3B01G013400 chr6D 98.243 2277 33 2 1 2273 458917724 458919997 0.000000e+00 3976.0
13 TraesCS3B01G013400 chr3D 97.586 2278 48 4 1 2273 48694788 48692513 0.000000e+00 3895.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G013400 chr3B 6000135 6002407 2272 False 4198 4198 100.000 1 2273 1 chr3B.!!$F1 2272
1 TraesCS3B01G013400 chr2B 449208697 449210969 2272 False 4098 4098 99.208 1 2273 1 chr2B.!!$F2 2272
2 TraesCS3B01G013400 chr2B 234530529 234532800 2271 False 4069 4069 98.988 1 2273 1 chr2B.!!$F1 2272
3 TraesCS3B01G013400 chr2B 474912189 474913125 936 False 1563 1563 96.908 1344 2273 1 chr2B.!!$F3 929
4 TraesCS3B01G013400 chr2B 1448268 1448925 657 True 1127 1127 97.568 1 658 1 chr2B.!!$R1 657
5 TraesCS3B01G013400 chr3A 495091909 495094180 2271 False 4085 4085 99.120 1 2273 1 chr3A.!!$F1 2272
6 TraesCS3B01G013400 chr7A 60220134 60222405 2271 False 4069 4069 98.988 1 2273 1 chr7A.!!$F1 2272
7 TraesCS3B01G013400 chr4B 495577616 495579887 2271 False 4030 4030 98.680 1 2273 1 chr4B.!!$F1 2272
8 TraesCS3B01G013400 chr1B 619184700 619186971 2271 False 4002 4002 98.460 1 2273 1 chr1B.!!$F1 2272
9 TraesCS3B01G013400 chr6D 458917724 458919997 2273 False 3976 3976 98.243 1 2273 1 chr6D.!!$F1 2272
10 TraesCS3B01G013400 chr3D 48692513 48694788 2275 True 3895 3895 97.586 1 2273 1 chr3D.!!$R1 2272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
446 447 3.597868 TCCTTCTTTTGATTGGGAGGGAT 59.402 43.478 0.0 0.0 30.75 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2165 2180 7.227049 TCGAGATTATGCAGGATTATACACA 57.773 36.0 0.0 0.0 0.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 7.418942 CCCTAGGTTGGGGATAATGAATTTTTG 60.419 40.741 8.29 0.0 46.50 2.44
446 447 3.597868 TCCTTCTTTTGATTGGGAGGGAT 59.402 43.478 0.00 0.0 30.75 3.85
488 489 4.104897 AGGAAAGTTCTCTACAAAAGGCCT 59.895 41.667 0.00 0.0 0.00 5.19
872 877 6.096282 TGTTTGAGAAGGAAAAAGGGTAACTG 59.904 38.462 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 3.010200 AGCATCTCCCAACAAGATTCC 57.990 47.619 0.00 0.0 31.05 3.01
287 288 2.031333 CACAGTCAGCCAGAAAAGCTTC 60.031 50.000 0.00 0.0 38.95 3.86
488 489 4.624364 CTGGGTGTGACAGGCGCA 62.624 66.667 10.83 0.0 32.38 6.09
550 551 2.355132 GCGATAGTCTTCTTCACGGAGA 59.645 50.000 0.00 0.0 39.35 3.71
2165 2180 7.227049 TCGAGATTATGCAGGATTATACACA 57.773 36.000 0.00 0.0 0.00 3.72


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.