Multiple sequence alignment - TraesCS3B01G011700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G011700 chr3B 100.000 2365 0 0 1 2365 5206159 5208523 0.000000e+00 4368.0
1 TraesCS3B01G011700 chr3B 97.346 1733 6 2 1 1693 3630227 3628495 0.000000e+00 2909.0
2 TraesCS3B01G011700 chr3B 98.442 642 5 1 1724 2365 3628517 3627881 0.000000e+00 1125.0
3 TraesCS3B01G011700 chr3B 100.000 170 0 0 2590 2759 5208748 5208917 5.740000e-82 315.0
4 TraesCS3B01G011700 chr3B 98.824 170 2 0 2590 2759 3627886 3627717 1.240000e-78 303.0
5 TraesCS3B01G011700 chr3B 92.262 168 12 1 2590 2757 429279507 429279341 1.280000e-58 237.0
6 TraesCS3B01G011700 chr3D 89.179 536 47 6 1060 1595 1602971 1602447 0.000000e+00 658.0
7 TraesCS3B01G011700 chr3D 88.419 449 37 9 38 480 1604190 1603751 6.770000e-146 527.0
8 TraesCS3B01G011700 chr3D 84.400 500 50 14 535 1027 1603509 1603031 1.500000e-127 466.0
9 TraesCS3B01G011700 chr3D 87.234 376 41 6 1992 2365 527141163 527141533 3.290000e-114 422.0
10 TraesCS3B01G011700 chr3D 83.200 375 51 8 1992 2365 330263955 330264318 1.580000e-87 333.0
11 TraesCS3B01G011700 chr3D 95.775 71 3 0 1737 1807 1593698 1593628 6.240000e-22 115.0
12 TraesCS3B01G011700 chr3D 79.487 117 16 4 142 253 560352430 560352317 2.950000e-10 76.8
13 TraesCS3B01G011700 chr3A 84.320 676 69 18 1060 1729 7432767 7432123 6.490000e-176 627.0
14 TraesCS3B01G011700 chr3A 81.948 421 56 14 535 948 7433317 7432910 3.400000e-89 339.0
15 TraesCS3B01G011700 chr1A 88.503 374 42 1 1992 2365 521876464 521876092 4.190000e-123 451.0
16 TraesCS3B01G011700 chr6D 88.710 372 35 3 1994 2365 386907095 386907459 5.420000e-122 448.0
17 TraesCS3B01G011700 chr6D 92.262 168 13 0 2590 2757 456309909 456310076 3.550000e-59 239.0
18 TraesCS3B01G011700 chr4D 87.302 378 35 10 1992 2365 465024256 465023888 1.180000e-113 420.0
19 TraesCS3B01G011700 chr4D 92.857 168 12 0 2590 2757 13340502 13340669 7.630000e-61 244.0
20 TraesCS3B01G011700 chr2B 86.096 374 46 4 1992 2365 463345241 463345608 5.540000e-107 398.0
21 TraesCS3B01G011700 chr2B 93.452 168 11 0 2590 2757 433107313 433107146 1.640000e-62 250.0
22 TraesCS3B01G011700 chr1D 85.942 377 42 5 1990 2365 426441532 426441166 2.580000e-105 392.0
23 TraesCS3B01G011700 chr5B 85.067 375 50 5 1992 2364 241858770 241859140 7.210000e-101 377.0
24 TraesCS3B01G011700 chr7A 84.800 375 49 8 1992 2364 502625393 502625761 1.210000e-98 370.0
25 TraesCS3B01G011700 chr7A 92.353 170 13 0 2590 2759 222930408 222930577 2.750000e-60 243.0
26 TraesCS3B01G011700 chr7A 94.444 36 1 1 187 221 721217585 721217620 1.000000e-03 54.7
27 TraesCS3B01G011700 chr5D 94.048 168 10 0 2590 2757 13337109 13336942 3.530000e-64 255.0
28 TraesCS3B01G011700 chr5D 92.262 168 13 0 2590 2757 424914454 424914621 3.550000e-59 239.0
29 TraesCS3B01G011700 chr5D 84.524 84 12 1 182 264 232286538 232286455 6.330000e-12 82.4
30 TraesCS3B01G011700 chr2D 93.373 166 11 0 2590 2755 152876057 152876222 2.120000e-61 246.0
31 TraesCS3B01G011700 chr7D 77.333 150 23 8 169 307 92445363 92445214 8.190000e-11 78.7
32 TraesCS3B01G011700 chr6B 91.228 57 3 1 170 224 685357429 685357373 2.950000e-10 76.8
33 TraesCS3B01G011700 chr5A 91.304 46 3 1 179 224 386465176 386465132 8.250000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G011700 chr3B 5206159 5208917 2758 False 2341.500000 4368 100.000000 1 2759 2 chr3B.!!$F1 2758
1 TraesCS3B01G011700 chr3B 3627717 3630227 2510 True 1445.666667 2909 98.204000 1 2759 3 chr3B.!!$R2 2758
2 TraesCS3B01G011700 chr3D 1602447 1604190 1743 True 550.333333 658 87.332667 38 1595 3 chr3D.!!$R3 1557
3 TraesCS3B01G011700 chr3A 7432123 7433317 1194 True 483.000000 627 83.134000 535 1729 2 chr3A.!!$R1 1194

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
880 1087 1.138036 CGACCCGTAGCGTCAATCA 59.862 57.895 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2597 2888 0.036671 AAACTCCTACGAAAGCGGGG 60.037 55.0 0.0 0.0 43.17 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
531 695 3.589654 CTTCCCCGTGCGCAGAAGA 62.590 63.158 24.96 12.17 38.38 2.87
880 1087 1.138036 CGACCCGTAGCGTCAATCA 59.862 57.895 0.00 0.00 0.00 2.57
1186 1472 3.406361 CGTGTCGCTCTGCACCAC 61.406 66.667 0.00 0.00 32.40 4.16
1680 1970 4.247267 TCTCGATTTTTGGTGTACTCGT 57.753 40.909 0.00 0.00 0.00 4.18
1681 1971 5.375417 TCTCGATTTTTGGTGTACTCGTA 57.625 39.130 0.00 0.00 0.00 3.43
1684 1974 4.327898 TCGATTTTTGGTGTACTCGTATGC 59.672 41.667 0.00 0.00 0.00 3.14
1707 1998 3.185365 CGTAGCGACGGCATGCAA 61.185 61.111 21.36 0.00 45.63 4.08
1708 1999 2.735677 CGTAGCGACGGCATGCAAA 61.736 57.895 21.36 0.00 45.63 3.68
1710 2001 2.106074 TAGCGACGGCATGCAAAGG 61.106 57.895 21.36 7.86 43.41 3.11
1711 2002 2.796483 TAGCGACGGCATGCAAAGGT 62.796 55.000 21.36 14.73 43.41 3.50
1712 2003 2.953821 CGACGGCATGCAAAGGTT 59.046 55.556 21.36 0.00 0.00 3.50
1713 2004 1.285641 CGACGGCATGCAAAGGTTT 59.714 52.632 21.36 0.00 0.00 3.27
1714 2005 1.003262 CGACGGCATGCAAAGGTTTG 61.003 55.000 21.36 4.91 41.03 2.93
1715 2006 0.667184 GACGGCATGCAAAGGTTTGG 60.667 55.000 21.36 0.00 38.57 3.28
2042 2333 1.967762 CGTCCGTTTAGCGTAGAACA 58.032 50.000 0.00 0.00 39.32 3.18
2043 2334 2.318578 CGTCCGTTTAGCGTAGAACAA 58.681 47.619 0.00 0.00 39.32 2.83
2144 2435 1.349688 ACTTGTGCCGAGTTTGGGATA 59.650 47.619 0.00 0.00 0.00 2.59
2618 2909 1.463444 CCCGCTTTCGTAGGAGTTTTG 59.537 52.381 0.00 0.00 0.00 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
531 695 2.571653 TCCAGAAAATCCACGACCAGAT 59.428 45.455 0.00 0.00 0.00 2.90
1680 1970 0.315301 CGTCGCTACGTACGTGCATA 60.315 55.000 30.25 17.65 44.21 3.14
1681 1971 1.581912 CGTCGCTACGTACGTGCAT 60.582 57.895 30.25 6.24 44.21 3.96
1692 1982 2.106074 CCTTTGCATGCCGTCGCTA 61.106 57.895 16.68 0.00 35.36 4.26
1693 1983 3.434319 CCTTTGCATGCCGTCGCT 61.434 61.111 16.68 0.00 35.36 4.93
1703 1994 3.477224 GACGCGCCAAACCTTTGCA 62.477 57.895 5.73 0.00 36.86 4.08
1704 1995 2.729491 GACGCGCCAAACCTTTGC 60.729 61.111 5.73 0.00 36.86 3.68
1705 1996 2.050442 GGACGCGCCAAACCTTTG 60.050 61.111 5.73 0.00 37.90 2.77
1706 1997 3.656045 CGGACGCGCCAAACCTTT 61.656 61.111 5.73 0.00 35.94 3.11
1711 2002 4.296593 TACACCGGACGCGCCAAA 62.297 61.111 9.46 0.00 35.94 3.28
1732 2023 2.174764 CTCACTCACGTACGTGCATAC 58.825 52.381 37.13 0.00 45.04 2.39
2042 2333 1.579084 TTTGGCCGCGCTATTCGTTT 61.579 50.000 5.56 0.00 41.07 3.60
2043 2334 2.036006 TTTGGCCGCGCTATTCGTT 61.036 52.632 5.56 0.00 41.07 3.85
2144 2435 1.301087 TCCGCGTGATGTCCGTTTT 60.301 52.632 4.92 0.00 0.00 2.43
2200 2491 1.076014 TGCTAGTGTCCCCGACAGA 59.924 57.895 0.00 0.00 43.57 3.41
2320 2611 3.332445 TTTGGTATGGACGGGCGGG 62.332 63.158 0.00 0.00 0.00 6.13
2321 2612 2.110352 GTTTGGTATGGACGGGCGG 61.110 63.158 0.00 0.00 0.00 6.13
2322 2613 2.110352 GGTTTGGTATGGACGGGCG 61.110 63.158 0.00 0.00 0.00 6.13
2592 2883 4.745751 TACGAAAGCGGGGGCGTG 62.746 66.667 0.00 0.00 43.17 5.34
2593 2884 4.446413 CTACGAAAGCGGGGGCGT 62.446 66.667 0.00 0.00 43.17 5.68
2595 2886 3.735037 CTCCTACGAAAGCGGGGGC 62.735 68.421 0.00 0.00 43.17 5.80
2596 2887 1.896122 AACTCCTACGAAAGCGGGGG 61.896 60.000 0.00 0.00 43.17 5.40
2597 2888 0.036671 AAACTCCTACGAAAGCGGGG 60.037 55.000 0.00 0.00 43.17 5.73
2598 2889 1.463444 CAAAACTCCTACGAAAGCGGG 59.537 52.381 0.00 0.00 43.17 6.13
2599 2890 1.463444 CCAAAACTCCTACGAAAGCGG 59.537 52.381 0.00 0.00 43.17 5.52
2600 2891 1.136057 GCCAAAACTCCTACGAAAGCG 60.136 52.381 0.00 0.00 44.79 4.68
2618 2909 4.821589 CTCCTCCAAGCGACGGCC 62.822 72.222 0.00 0.00 41.24 6.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.