Multiple sequence alignment - TraesCS3B01G011400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G011400 chr3B 100.000 2876 0 0 1 2876 5171248 5174123 0.000000e+00 5312.0
1 TraesCS3B01G011400 chr3B 99.653 2017 7 0 860 2876 3664199 3662183 0.000000e+00 3687.0
2 TraesCS3B01G011400 chr3B 98.148 864 10 3 1 864 3665101 3664244 0.000000e+00 1502.0
3 TraesCS3B01G011400 chr3A 92.074 2044 126 10 860 2876 7472804 7470770 0.000000e+00 2844.0
4 TraesCS3B01G011400 chr3A 92.534 817 27 9 23 822 7474644 7473845 0.000000e+00 1140.0
5 TraesCS3B01G011400 chr3A 92.727 55 4 0 800 854 7473837 7473783 2.380000e-11 80.5
6 TraesCS3B01G011400 chr3D 91.238 2020 144 20 862 2876 1636843 1634852 0.000000e+00 2719.0
7 TraesCS3B01G011400 chrUn 100.000 79 0 0 2798 2876 480652057 480652135 2.310000e-31 147.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G011400 chr3B 5171248 5174123 2875 False 5312.000000 5312 100.0000 1 2876 1 chr3B.!!$F1 2875
1 TraesCS3B01G011400 chr3B 3662183 3665101 2918 True 2594.500000 3687 98.9005 1 2876 2 chr3B.!!$R1 2875
2 TraesCS3B01G011400 chr3A 7470770 7474644 3874 True 1354.833333 2844 92.4450 23 2876 3 chr3A.!!$R1 2853
3 TraesCS3B01G011400 chr3D 1634852 1636843 1991 True 2719.000000 2719 91.2380 862 2876 1 chr3D.!!$R1 2014

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
599 617 0.322906 GCCTCCCTTCTCCAACCAAG 60.323 60.0 0.0 0.0 0.0 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2597 3699 7.573843 GCGATATCATCATAAGAAACTTTGGGG 60.574 40.741 3.12 0.0 0.0 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 239 7.009083 CGTTCAGTGAGCTATGAATATGATAGC 59.991 40.741 14.98 14.98 45.92 2.97
599 617 0.322906 GCCTCCCTTCTCCAACCAAG 60.323 60.000 0.00 0.00 0.00 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
599 617 3.774702 GGAAGAACGTCGTGCGCC 61.775 66.667 4.18 0.0 46.11 6.53
2597 3699 7.573843 GCGATATCATCATAAGAAACTTTGGGG 60.574 40.741 3.12 0.0 0.00 4.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.