Multiple sequence alignment - TraesCS3B01G011100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G011100 chr3B 100.000 2300 0 0 1 2300 5082608 5084907 0 4248
1 TraesCS3B01G011100 chr3B 98.913 2300 24 1 1 2300 92266388 92264090 0 4108
2 TraesCS3B01G011100 chr3B 98.521 2299 32 1 1 2299 92147456 92145160 0 4056
3 TraesCS3B01G011100 chr1B 99.304 2300 15 1 1 2300 683729610 683731908 0 4157
4 TraesCS3B01G011100 chr7B 98.957 2300 23 1 1 2300 698144693 698142395 0 4113
5 TraesCS3B01G011100 chr6B 98.913 2300 24 1 1 2300 128916648 128914350 0 4108
6 TraesCS3B01G011100 chr2A 98.870 2300 25 1 1 2300 563261173 563258875 0 4102
7 TraesCS3B01G011100 chr2A 98.392 2301 35 2 1 2300 735141324 735139025 0 4043
8 TraesCS3B01G011100 chr5B 98.740 2301 26 3 1 2300 713077687 713079985 0 4085
9 TraesCS3B01G011100 chrUn 98.696 2300 28 2 1 2300 40090392 40088095 0 4080


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G011100 chr3B 5082608 5084907 2299 False 4248 4248 100.000 1 2300 1 chr3B.!!$F1 2299
1 TraesCS3B01G011100 chr3B 92264090 92266388 2298 True 4108 4108 98.913 1 2300 1 chr3B.!!$R2 2299
2 TraesCS3B01G011100 chr3B 92145160 92147456 2296 True 4056 4056 98.521 1 2299 1 chr3B.!!$R1 2298
3 TraesCS3B01G011100 chr1B 683729610 683731908 2298 False 4157 4157 99.304 1 2300 1 chr1B.!!$F1 2299
4 TraesCS3B01G011100 chr7B 698142395 698144693 2298 True 4113 4113 98.957 1 2300 1 chr7B.!!$R1 2299
5 TraesCS3B01G011100 chr6B 128914350 128916648 2298 True 4108 4108 98.913 1 2300 1 chr6B.!!$R1 2299
6 TraesCS3B01G011100 chr2A 563258875 563261173 2298 True 4102 4102 98.870 1 2300 1 chr2A.!!$R1 2299
7 TraesCS3B01G011100 chr2A 735139025 735141324 2299 True 4043 4043 98.392 1 2300 1 chr2A.!!$R2 2299
8 TraesCS3B01G011100 chr5B 713077687 713079985 2298 False 4085 4085 98.740 1 2300 1 chr5B.!!$F1 2299
9 TraesCS3B01G011100 chrUn 40088095 40090392 2297 True 4080 4080 98.696 1 2300 1 chrUn.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
546 548 2.170397 TCTATTGGAAGAGATGGCGCAA 59.83 45.455 10.83 0.0 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1823 1825 0.250513 GAGGCAGAAACTCGTCCCAT 59.749 55.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
350 351 2.487762 ACGTTCCGTAGAAACATACCGA 59.512 45.455 0.00 0.0 38.73 4.69
546 548 2.170397 TCTATTGGAAGAGATGGCGCAA 59.830 45.455 10.83 0.0 0.00 4.85
721 723 5.227908 AGAATAACCTTCGTGTATATGCGG 58.772 41.667 0.00 0.0 0.00 5.69
1275 1277 2.366167 AGCCTCCCGATGAAGCCT 60.366 61.111 0.00 0.0 30.16 4.58
1699 1701 1.531149 CGAGACCTCGCAAACAACAAT 59.469 47.619 6.49 0.0 46.50 2.71
1761 1763 9.436957 AATCGTTGAGTGAACTGTATCTTATTT 57.563 29.630 0.00 0.0 31.70 1.40
2041 2044 0.679002 TCATCCCTTGCTTGCTGCTC 60.679 55.000 0.00 0.0 43.37 4.26
2192 2195 4.540715 CCCTAAATGGAATGGCTCTCTTT 58.459 43.478 0.00 0.0 38.35 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
350 351 7.766278 GTCTGTGTGGATTTGAGTCATAGTATT 59.234 37.037 0.00 0.00 0.00 1.89
546 548 1.357420 TGGTGATTGGCCTTGTATGGT 59.643 47.619 3.32 0.00 0.00 3.55
721 723 4.474226 GAAGAAATCGATACCATGGTGC 57.526 45.455 28.17 17.51 0.00 5.01
1660 1662 4.347876 TCTCGATCATTTACATGGACCCAT 59.652 41.667 0.00 0.00 37.08 4.00
1699 1701 2.858644 ACTCCATATGGGGAAGGAACA 58.141 47.619 28.98 0.99 38.16 3.18
1761 1763 3.196039 TGCGGCTTAGGTCAACTAATACA 59.804 43.478 0.00 0.00 40.71 2.29
1823 1825 0.250513 GAGGCAGAAACTCGTCCCAT 59.749 55.000 0.00 0.00 0.00 4.00
1971 1974 0.741915 TGCTGGGTCGGTTTGTTTTC 59.258 50.000 0.00 0.00 0.00 2.29
2041 2044 2.544267 GGATGGAATAGAAAGAACGCGG 59.456 50.000 12.47 0.00 0.00 6.46
2192 2195 3.617735 TCGGGGCACAGCGTAACA 61.618 61.111 0.00 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.