Multiple sequence alignment - TraesCS3B01G010900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G010900 chr3B 100.000 3240 0 0 1 3240 5074689 5077928 0.000000e+00 5984.0
1 TraesCS3B01G010900 chr3B 99.406 3200 16 3 1 3197 4219244 4222443 0.000000e+00 5801.0
2 TraesCS3B01G010900 chr3B 100.000 39 0 0 3202 3240 4222497 4222535 4.480000e-09 73.1
3 TraesCS3B01G010900 chr3A 93.279 982 53 6 891 1859 7125895 7124914 0.000000e+00 1435.0
4 TraesCS3B01G010900 chr3A 89.729 886 61 13 1 881 7126891 7126031 0.000000e+00 1105.0
5 TraesCS3B01G010900 chr3A 85.635 543 42 15 2025 2536 7124513 7123976 3.680000e-149 538.0
6 TraesCS3B01G010900 chr3A 95.238 147 5 1 3060 3206 436524134 436524278 6.990000e-57 231.0
7 TraesCS3B01G010900 chr3A 95.745 141 6 0 1885 2025 7124920 7124780 9.040000e-56 228.0
8 TraesCS3B01G010900 chr3A 97.436 39 1 0 3202 3240 436524318 436524356 2.090000e-07 67.6
9 TraesCS3B01G010900 chr3D 93.786 869 52 2 891 1757 1889816 1890684 0.000000e+00 1304.0
10 TraesCS3B01G010900 chr3D 92.663 736 45 4 144 878 1888951 1889678 0.000000e+00 1051.0
11 TraesCS3B01G010900 chr3D 87.921 356 29 4 2637 2981 1891834 1892186 1.080000e-109 407.0
12 TraesCS3B01G010900 chr3D 95.205 146 7 0 1 146 1887626 1887771 6.990000e-57 231.0
13 TraesCS3B01G010900 chr3D 93.289 149 8 1 3060 3206 582570999 582571147 5.440000e-53 219.0
14 TraesCS3B01G010900 chr3D 82.028 217 31 7 2343 2558 1891617 1891826 9.240000e-41 178.0
15 TraesCS3B01G010900 chr3D 89.474 114 10 1 2138 2251 401895936 401895825 3.370000e-30 143.0
16 TraesCS3B01G010900 chrUn 100.000 401 0 0 2589 2989 478615682 478616082 0.000000e+00 741.0
17 TraesCS3B01G010900 chr7B 97.744 133 3 0 3060 3192 466676668 466676536 2.510000e-56 230.0
18 TraesCS3B01G010900 chr7B 96.386 83 3 0 2977 3059 413721537 413721619 1.570000e-28 137.0
19 TraesCS3B01G010900 chr7B 95.238 84 4 0 2976 3059 118681575 118681658 2.030000e-27 134.0
20 TraesCS3B01G010900 chr7B 93.407 91 5 1 2969 3059 642496246 642496157 2.030000e-27 134.0
21 TraesCS3B01G010900 chr4B 97.744 133 3 0 3060 3192 5356785 5356653 2.510000e-56 230.0
22 TraesCS3B01G010900 chr4B 94.595 148 7 1 3060 3206 525291050 525291197 9.040000e-56 228.0
23 TraesCS3B01G010900 chr4B 96.296 81 3 0 2979 3059 562739302 562739222 2.030000e-27 134.0
24 TraesCS3B01G010900 chr4B 90.909 55 5 0 1 55 506917799 506917853 1.250000e-09 75.0
25 TraesCS3B01G010900 chr7D 94.558 147 7 1 3061 3206 632795571 632795425 3.250000e-55 226.0
26 TraesCS3B01G010900 chr7D 100.000 36 0 0 3205 3240 557926947 557926912 2.090000e-07 67.6
27 TraesCS3B01G010900 chr4D 93.878 147 8 1 3060 3206 509348215 509348070 1.510000e-53 220.0
28 TraesCS3B01G010900 chr5B 93.197 147 10 0 3060 3206 707930427 707930573 1.960000e-52 217.0
29 TraesCS3B01G010900 chr5B 86.885 122 13 3 2169 2288 706840798 706840918 2.030000e-27 134.0
30 TraesCS3B01G010900 chr5B 94.545 55 3 0 1 55 47047284 47047338 5.760000e-13 86.1
31 TraesCS3B01G010900 chr5B 94.545 55 3 0 1 55 47081665 47081719 5.760000e-13 86.1
32 TraesCS3B01G010900 chr5B 92.727 55 4 0 1 55 47116888 47116942 2.680000e-11 80.5
33 TraesCS3B01G010900 chr1B 85.612 139 18 2 2149 2285 390427061 390427199 9.370000e-31 145.0
34 TraesCS3B01G010900 chr1B 82.639 144 22 3 2164 2305 98903317 98903175 1.220000e-24 124.0
35 TraesCS3B01G010900 chr1B 100.000 36 0 0 3205 3240 249226046 249226011 2.090000e-07 67.6
36 TraesCS3B01G010900 chr6A 97.500 80 2 0 2980 3059 600701752 600701831 1.570000e-28 137.0
37 TraesCS3B01G010900 chr2B 95.294 85 4 0 2975 3059 208229068 208229152 5.640000e-28 135.0
38 TraesCS3B01G010900 chr2B 93.333 45 1 2 3197 3239 730092544 730092588 7.500000e-07 65.8
39 TraesCS3B01G010900 chr7A 95.238 84 4 0 2976 3059 110784075 110783992 2.030000e-27 134.0
40 TraesCS3B01G010900 chr7A 87.692 65 4 2 3 64 732577151 732577214 4.480000e-09 73.1
41 TraesCS3B01G010900 chr7A 97.436 39 1 0 3202 3240 725576988 725577026 2.090000e-07 67.6
42 TraesCS3B01G010900 chr5D 96.296 81 3 0 2979 3059 513514662 513514582 2.030000e-27 134.0
43 TraesCS3B01G010900 chr5D 83.333 138 20 3 2164 2300 522113276 522113411 1.220000e-24 124.0
44 TraesCS3B01G010900 chr5D 92.188 64 4 1 1 64 553674770 553674832 4.450000e-14 89.8
45 TraesCS3B01G010900 chr5D 100.000 36 0 0 3205 3240 416855237 416855202 2.090000e-07 67.6
46 TraesCS3B01G010900 chr5A 83.333 138 20 3 2164 2300 650247758 650247893 1.220000e-24 124.0
47 TraesCS3B01G010900 chr1D 79.290 169 32 3 2139 2305 488548136 488547969 7.350000e-22 115.0
48 TraesCS3B01G010900 chr1D 96.364 55 2 0 1 55 31154807 31154861 1.240000e-14 91.6
49 TraesCS3B01G010900 chr1D 100.000 36 0 0 3205 3240 433104116 433104081 2.090000e-07 67.6
50 TraesCS3B01G010900 chr6B 88.333 60 5 2 1 59 668902948 668902890 1.610000e-08 71.3
51 TraesCS3B01G010900 chr6D 100.000 36 0 0 3205 3240 232428343 232428378 2.090000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G010900 chr3B 5074689 5077928 3239 False 5984.00 5984 100.0000 1 3240 1 chr3B.!!$F1 3239
1 TraesCS3B01G010900 chr3B 4219244 4222535 3291 False 2937.05 5801 99.7030 1 3240 2 chr3B.!!$F2 3239
2 TraesCS3B01G010900 chr3A 7123976 7126891 2915 True 826.50 1435 91.0970 1 2536 4 chr3A.!!$R1 2535
3 TraesCS3B01G010900 chr3D 1887626 1892186 4560 False 634.20 1304 90.3206 1 2981 5 chr3D.!!$F2 2980

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
236 1420 9.04415 GTATGAAATGAATCTTCCTTCTCAGAG 57.956 37.037 0.0 0.0 0.0 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2587 4592 3.746045 TGTGACTACACCAAGTCTTCC 57.254 47.619 5.68 0.0 45.12 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 1420 9.044150 GTATGAAATGAATCTTCCTTCTCAGAG 57.956 37.037 0.00 0.00 0.00 3.35
1008 2324 9.671279 TTCCCTTGTGCATATCTTACATATATG 57.329 33.333 11.29 11.29 39.36 1.78
2587 4592 3.303132 GCATACTATTTCAAACCGAGCCG 60.303 47.826 0.00 0.00 0.00 5.52
2989 5005 0.264955 GATCCCACCTACTCCCTCCA 59.735 60.000 0.00 0.00 0.00 3.86
3154 5170 9.296400 GCATTTCTAAAAGAACTTGTTAACACA 57.704 29.630 8.07 0.00 33.26 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 1397 7.013823 ACTCTGAGAAGGAAGATTCATTTCA 57.986 36.000 12.44 7.64 30.50 2.69
948 2262 2.221169 TGATGCGCCTTAATGATGGTC 58.779 47.619 4.18 0.00 0.00 4.02
1008 2324 4.446051 GTGCAGTACACTCAACTCTTTCTC 59.554 45.833 0.00 0.00 46.41 2.87
2587 4592 3.746045 TGTGACTACACCAAGTCTTCC 57.254 47.619 5.68 0.00 45.12 3.46
2989 5005 9.965902 ACAAAGTTGAGTCATCTATTTAGGAAT 57.034 29.630 4.14 0.00 0.00 3.01
3154 5170 0.541863 GGTGGGGATTGTCTCGACAT 59.458 55.000 0.00 0.00 41.52 3.06
3155 5171 1.550130 GGGTGGGGATTGTCTCGACA 61.550 60.000 0.00 0.00 39.98 4.35
3197 5213 6.092346 AGAGGAAAGGCCACCTATTAAAAT 57.908 37.500 14.56 0.00 40.02 1.82
3198 5214 5.530176 AGAGGAAAGGCCACCTATTAAAA 57.470 39.130 14.56 0.00 40.02 1.52
3199 5215 5.530176 AAGAGGAAAGGCCACCTATTAAA 57.470 39.130 17.58 0.00 36.20 1.52
3200 5216 5.530176 AAAGAGGAAAGGCCACCTATTAA 57.470 39.130 18.78 0.00 36.83 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.