Multiple sequence alignment - TraesCS3B01G010000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G010000 chr3B 100.000 5249 0 0 1 5249 4701009 4706257 0.000000e+00 9694.0
1 TraesCS3B01G010000 chr3B 99.124 5250 42 4 1 5249 3802531 3807777 0.000000e+00 9437.0
2 TraesCS3B01G010000 chr3B 91.641 658 48 5 1 652 481919477 481920133 0.000000e+00 904.0
3 TraesCS3B01G010000 chr3B 90.826 654 56 4 1 652 715679736 715680387 0.000000e+00 872.0
4 TraesCS3B01G010000 chr3A 91.017 2772 226 17 2097 4859 7386930 7384173 0.000000e+00 3718.0
5 TraesCS3B01G010000 chr3A 89.526 1795 159 14 2707 4480 7312804 7311018 0.000000e+00 2246.0
6 TraesCS3B01G010000 chr3A 85.506 1373 132 47 762 2105 7389171 7387837 0.000000e+00 1371.0
7 TraesCS3B01G010000 chr3A 92.297 753 40 7 4511 5249 7311018 7310270 0.000000e+00 1053.0
8 TraesCS3B01G010000 chr3A 83.598 1006 122 31 870 1855 7315044 7314062 0.000000e+00 904.0
9 TraesCS3B01G010000 chr3A 81.841 402 42 21 4869 5242 7363909 7363511 5.110000e-80 309.0
10 TraesCS3B01G010000 chr3A 94.828 58 3 0 652 709 7390211 7390154 2.010000e-14 91.6
11 TraesCS3B01G010000 chr3A 100.000 34 0 0 734 767 7328640 7328607 4.390000e-06 63.9
12 TraesCS3B01G010000 chr3D 93.393 2134 130 6 2933 5062 1658122 1660248 0.000000e+00 3149.0
13 TraesCS3B01G010000 chr3D 87.627 1083 102 17 758 1831 1655835 1656894 0.000000e+00 1229.0
14 TraesCS3B01G010000 chr3D 85.965 342 32 7 4920 5247 1647733 1648072 8.360000e-93 351.0
15 TraesCS3B01G010000 chr3D 97.368 190 5 0 5060 5249 1660490 1660679 1.820000e-84 324.0
16 TraesCS3B01G010000 chr3D 95.000 60 3 0 3733 3792 1708269 1708328 1.560000e-15 95.3
17 TraesCS3B01G010000 chrUn 100.000 1201 0 0 505 1705 426378438 426377238 0.000000e+00 2218.0
18 TraesCS3B01G010000 chrUn 90.658 653 56 4 1 651 85134314 85134963 0.000000e+00 863.0
19 TraesCS3B01G010000 chr4A 95.245 652 26 2 1 651 706544763 706545410 0.000000e+00 1027.0
20 TraesCS3B01G010000 chr2D 91.118 653 54 4 1 651 589637859 589638509 0.000000e+00 881.0
21 TraesCS3B01G010000 chr7D 91.006 656 50 9 1 653 534372355 534371706 0.000000e+00 876.0
22 TraesCS3B01G010000 chr5D 90.951 652 53 6 1 649 98248729 98248081 0.000000e+00 872.0
23 TraesCS3B01G010000 chr1A 90.196 663 58 6 1 657 344215257 344215918 0.000000e+00 857.0
24 TraesCS3B01G010000 chr6A 80.077 1039 175 23 3099 4124 574526098 574525079 0.000000e+00 743.0
25 TraesCS3B01G010000 chr6B 79.683 1009 171 26 3099 4093 646742445 646741457 0.000000e+00 697.0
26 TraesCS3B01G010000 chr6B 77.303 912 167 33 954 1834 2072247 2073149 7.850000e-138 501.0
27 TraesCS3B01G010000 chr6B 77.069 894 162 35 973 1834 5790390 5791272 4.760000e-130 475.0
28 TraesCS3B01G010000 chr2B 80.178 787 130 15 1071 1834 755591473 755592256 2.740000e-157 566.0
29 TraesCS3B01G010000 chr6D 77.936 911 162 32 955 1840 606150 605254 2.780000e-147 532.0
30 TraesCS3B01G010000 chr6D 76.865 925 157 47 954 1834 1488749 1489660 2.210000e-128 470.0
31 TraesCS3B01G010000 chr4D 77.297 925 155 31 955 1840 19755814 19754906 1.310000e-135 494.0
32 TraesCS3B01G010000 chr4D 77.253 699 106 33 955 1615 19774359 19775042 1.390000e-95 361.0
33 TraesCS3B01G010000 chr4B 75.540 278 58 8 4429 4700 434599605 434599878 1.530000e-25 128.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G010000 chr3B 4701009 4706257 5248 False 9694.000000 9694 100.000000 1 5249 1 chr3B.!!$F2 5248
1 TraesCS3B01G010000 chr3B 3802531 3807777 5246 False 9437.000000 9437 99.124000 1 5249 1 chr3B.!!$F1 5248
2 TraesCS3B01G010000 chr3B 481919477 481920133 656 False 904.000000 904 91.641000 1 652 1 chr3B.!!$F3 651
3 TraesCS3B01G010000 chr3B 715679736 715680387 651 False 872.000000 872 90.826000 1 652 1 chr3B.!!$F4 651
4 TraesCS3B01G010000 chr3A 7384173 7390211 6038 True 1726.866667 3718 90.450333 652 4859 3 chr3A.!!$R4 4207
5 TraesCS3B01G010000 chr3A 7310270 7315044 4774 True 1401.000000 2246 88.473667 870 5249 3 chr3A.!!$R3 4379
6 TraesCS3B01G010000 chr3D 1655835 1660679 4844 False 1567.333333 3149 92.796000 758 5249 3 chr3D.!!$F3 4491
7 TraesCS3B01G010000 chrUn 426377238 426378438 1200 True 2218.000000 2218 100.000000 505 1705 1 chrUn.!!$R1 1200
8 TraesCS3B01G010000 chrUn 85134314 85134963 649 False 863.000000 863 90.658000 1 651 1 chrUn.!!$F1 650
9 TraesCS3B01G010000 chr4A 706544763 706545410 647 False 1027.000000 1027 95.245000 1 651 1 chr4A.!!$F1 650
10 TraesCS3B01G010000 chr2D 589637859 589638509 650 False 881.000000 881 91.118000 1 651 1 chr2D.!!$F1 650
11 TraesCS3B01G010000 chr7D 534371706 534372355 649 True 876.000000 876 91.006000 1 653 1 chr7D.!!$R1 652
12 TraesCS3B01G010000 chr5D 98248081 98248729 648 True 872.000000 872 90.951000 1 649 1 chr5D.!!$R1 648
13 TraesCS3B01G010000 chr1A 344215257 344215918 661 False 857.000000 857 90.196000 1 657 1 chr1A.!!$F1 656
14 TraesCS3B01G010000 chr6A 574525079 574526098 1019 True 743.000000 743 80.077000 3099 4124 1 chr6A.!!$R1 1025
15 TraesCS3B01G010000 chr6B 646741457 646742445 988 True 697.000000 697 79.683000 3099 4093 1 chr6B.!!$R1 994
16 TraesCS3B01G010000 chr6B 2072247 2073149 902 False 501.000000 501 77.303000 954 1834 1 chr6B.!!$F1 880
17 TraesCS3B01G010000 chr6B 5790390 5791272 882 False 475.000000 475 77.069000 973 1834 1 chr6B.!!$F2 861
18 TraesCS3B01G010000 chr2B 755591473 755592256 783 False 566.000000 566 80.178000 1071 1834 1 chr2B.!!$F1 763
19 TraesCS3B01G010000 chr6D 605254 606150 896 True 532.000000 532 77.936000 955 1840 1 chr6D.!!$R1 885
20 TraesCS3B01G010000 chr6D 1488749 1489660 911 False 470.000000 470 76.865000 954 1834 1 chr6D.!!$F1 880
21 TraesCS3B01G010000 chr4D 19754906 19755814 908 True 494.000000 494 77.297000 955 1840 1 chr4D.!!$R1 885
22 TraesCS3B01G010000 chr4D 19774359 19775042 683 False 361.000000 361 77.253000 955 1615 1 chr4D.!!$F1 660

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
441 451 9.942526 AGGAGGAGTTTTTGGATTGAAATATAT 57.057 29.630 0.0 0.0 0.0 0.86 F
2809 5727 0.320374 TCTTGGCGGATTCGAGTGTT 59.680 50.000 0.0 0.0 39.0 3.32 F
3076 6305 1.133598 CGACTAACCGTGGCATCTACA 59.866 52.381 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3191 6420 1.576421 CCTCCGTGCTGTTGAAAGC 59.424 57.895 0.0 0.0 43.82 3.51 R
4232 7467 3.190327 ACGATCTCATCTAGCGGATTCTG 59.810 47.826 0.0 0.0 31.27 3.02 R
5007 8246 6.249035 ACGGTGAACCTTTTTGTACATATG 57.751 37.500 0.0 0.0 0.00 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
441 451 9.942526 AGGAGGAGTTTTTGGATTGAAATATAT 57.057 29.630 0.0 0.0 0.00 0.86
2809 5727 0.320374 TCTTGGCGGATTCGAGTGTT 59.680 50.000 0.0 0.0 39.00 3.32
3076 6305 1.133598 CGACTAACCGTGGCATCTACA 59.866 52.381 0.0 0.0 0.00 2.74
3077 6306 2.416296 CGACTAACCGTGGCATCTACAA 60.416 50.000 0.0 0.0 0.00 2.41
3191 6420 5.884771 TCTGATTAGACAGAGTGACGAATG 58.115 41.667 0.0 0.0 41.21 2.67
3319 6554 2.102578 TCGACAAGGAGAGCATCATCA 58.897 47.619 0.0 0.0 37.82 3.07
3521 6756 2.124695 GTTCGAGGTGCCCATCCC 60.125 66.667 0.0 0.0 0.00 3.85
4169 7404 2.437281 CTGTCACAGATATGGGGAGCTT 59.563 50.000 0.0 0.0 32.44 3.74
4196 7431 1.627864 TCTGAGAATGACACCACCGA 58.372 50.000 0.0 0.0 0.00 4.69
4232 7467 0.242017 AAGAAAGCCGCATTGAGCAC 59.758 50.000 0.0 0.0 46.13 4.40
4730 7969 3.343941 TGGTGGTACATTAGCCAGAAC 57.656 47.619 0.0 0.0 44.52 3.01
4788 8027 7.698130 CAGATTTACAAGGGACGATTCAAAATC 59.302 37.037 0.0 0.0 33.24 2.17
5007 8246 6.128200 GCAAGAATTTCACAAAATCATTCCCC 60.128 38.462 0.0 0.0 33.93 4.81
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 6.851222 AATCTGTTTGCGTATTATCCTCTG 57.149 37.500 0.00 0.0 0.00 3.35
441 451 5.612261 TCCCCCTTGATCAATTCATCATCTA 59.388 40.000 8.96 0.0 32.69 1.98
3191 6420 1.576421 CCTCCGTGCTGTTGAAAGC 59.424 57.895 0.00 0.0 43.82 3.51
3319 6554 4.767892 CCCCTGCCCTCCTTCCCT 62.768 72.222 0.00 0.0 0.00 4.20
4196 7431 5.010112 GCTTTCTTCTCAAGGCTAAAAACCT 59.990 40.000 0.00 0.0 40.02 3.50
4232 7467 3.190327 ACGATCTCATCTAGCGGATTCTG 59.810 47.826 0.00 0.0 31.27 3.02
4730 7969 9.490379 AAGGAGTACTTATTGTAGTTGACAAAG 57.510 33.333 0.00 0.0 40.48 2.77
5007 8246 6.249035 ACGGTGAACCTTTTTGTACATATG 57.751 37.500 0.00 0.0 0.00 1.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.