Multiple sequence alignment - TraesCS3B01G008400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G008400 chr3B 100.000 2543 0 0 1 2543 4219318 4221860 0.000000e+00 4697
1 TraesCS3B01G008400 chr3B 99.371 2543 13 3 1 2543 5074763 5077302 0.000000e+00 4604
2 TraesCS3B01G008400 chr3A 93.177 982 54 6 818 1786 7125895 7124914 0.000000e+00 1430
3 TraesCS3B01G008400 chr3A 89.826 806 53 13 6 807 7126811 7126031 0.000000e+00 1007
4 TraesCS3B01G008400 chr3A 85.110 544 44 16 1952 2464 7124513 7123976 2.900000e-144 521
5 TraesCS3B01G008400 chr3A 95.745 141 6 0 1812 1952 7124920 7124780 7.080000e-56 228
6 TraesCS3B01G008400 chr3D 93.786 869 52 2 818 1684 1889816 1890684 0.000000e+00 1304
7 TraesCS3B01G008400 chr3D 92.799 736 44 4 70 804 1888951 1889678 0.000000e+00 1057
8 TraesCS3B01G008400 chr3D 81.651 218 31 6 2270 2486 1891617 1891826 3.360000e-39 172
9 TraesCS3B01G008400 chr3D 89.474 114 10 1 2065 2178 401895936 401895825 2.640000e-30 143
10 TraesCS3B01G008400 chr3D 97.015 67 2 0 6 72 1887705 1887771 2.070000e-21 113
11 TraesCS3B01G008400 chr1B 84.173 139 20 2 2076 2212 390427061 390427199 1.590000e-27 134
12 TraesCS3B01G008400 chr1B 81.250 144 24 3 2091 2232 98903317 98903175 2.070000e-21 113
13 TraesCS3B01G008400 chr5B 85.950 121 14 3 2097 2215 706840799 706840918 2.660000e-25 126
14 TraesCS3B01G008400 chr5D 81.884 138 22 3 2091 2227 522113276 522113411 2.070000e-21 113
15 TraesCS3B01G008400 chr2B 78.462 195 26 9 2092 2272 244916505 244916313 2.070000e-21 113
16 TraesCS3B01G008400 chr1D 78.107 169 34 3 2066 2232 488548136 488547969 1.240000e-18 104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G008400 chr3B 4219318 4221860 2542 False 4697.0 4697 100.00000 1 2543 1 chr3B.!!$F1 2542
1 TraesCS3B01G008400 chr3B 5074763 5077302 2539 False 4604.0 4604 99.37100 1 2543 1 chr3B.!!$F2 2542
2 TraesCS3B01G008400 chr3A 7123976 7126811 2835 True 796.5 1430 90.96450 6 2464 4 chr3A.!!$R1 2458
3 TraesCS3B01G008400 chr3D 1887705 1891826 4121 False 661.5 1304 91.31275 6 2486 4 chr3D.!!$F1 2480

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
934 2249 9.502091 TTTCCCTTGTGCATATCTTACATATAC 57.498 33.333 0.0 0.0 0.0 1.47 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2128 4099 1.271856 TGAGCAGGTAAATCACGGGA 58.728 50.0 0.0 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
934 2249 9.502091 TTTCCCTTGTGCATATCTTACATATAC 57.498 33.333 0.00 0.0 0.00 1.47
1733 3161 4.719040 CATGATGCGTGTATCAATGATGG 58.281 43.478 5.91 0.0 40.21 3.51
2095 4066 6.710295 ACATGTACTAGATTGTTTTCTGTGCA 59.290 34.615 0.00 0.0 30.62 4.57
2361 4348 4.704103 AGTGCTCTCCCCGGCAGA 62.704 66.667 0.00 0.0 39.22 4.26
2480 4482 7.334171 CCATGTAGAATATTTCAGTCACACACA 59.666 37.037 0.00 0.0 0.00 3.72
2516 4518 3.003378 GCATACTATTTCAAACCGAGCCC 59.997 47.826 0.00 0.0 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 1310 6.009115 AGATTCATTTCGTACCAAACCAAC 57.991 37.500 0.00 0.0 0.00 3.77
934 2249 4.811024 TGCAGTACACTCAACTCTTTCTTG 59.189 41.667 0.00 0.0 0.00 3.02
1733 3161 3.257393 CCCTAGATGAGCGAACATATGC 58.743 50.000 1.58 0.0 0.00 3.14
2128 4099 1.271856 TGAGCAGGTAAATCACGGGA 58.728 50.000 0.00 0.0 0.00 5.14
2257 4244 6.607735 TTTTTAACTGTCTTAACTGTCCCG 57.392 37.500 0.00 0.0 36.65 5.14
2516 4518 3.364889 TGTGACTACACCAAGTCTTCG 57.635 47.619 5.68 0.0 45.12 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.