Multiple sequence alignment - TraesCS3B01G007600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G007600 chr3B 100.000 4911 0 0 1 4911 3892702 3897612 0.000000e+00 9070.0
1 TraesCS3B01G007600 chr3B 99.674 4912 14 2 1 4911 4779628 4784538 0.000000e+00 8981.0
2 TraesCS3B01G007600 chr3A 90.645 2170 137 37 878 3030 7280348 7278228 0.000000e+00 2822.0
3 TraesCS3B01G007600 chr3A 89.548 995 70 17 3030 3998 7278117 7277131 0.000000e+00 1230.0
4 TraesCS3B01G007600 chr3A 89.089 889 45 20 4043 4911 7277134 7276278 0.000000e+00 1057.0
5 TraesCS3B01G007600 chr3D 92.754 1946 95 14 877 2789 1743719 1745651 0.000000e+00 2771.0
6 TraesCS3B01G007600 chr3D 89.994 1809 101 34 3150 4911 1745652 1747427 0.000000e+00 2265.0
7 TraesCS3B01G007600 chr7A 82.564 866 129 16 1666 2527 21359190 21358343 0.000000e+00 743.0
8 TraesCS3B01G007600 chr7A 84.333 600 73 10 1018 1614 21359889 21359308 7.130000e-158 568.0
9 TraesCS3B01G007600 chr7A 84.462 251 30 6 3269 3513 21355584 21355337 6.350000e-59 239.0
10 TraesCS3B01G007600 chr4A 84.288 611 74 9 1004 1611 669234991 669235582 1.190000e-160 577.0
11 TraesCS3B01G007600 chr7D 83.636 605 70 15 1013 1614 21009083 21008505 4.320000e-150 542.0
12 TraesCS3B01G007600 chr2D 90.435 115 11 0 25 139 294861435 294861321 8.510000e-33 152.0
13 TraesCS3B01G007600 chr2D 84.348 115 18 0 25 139 298040266 298040152 4.020000e-21 113.0
14 TraesCS3B01G007600 chr2D 81.818 121 20 2 25 145 371223614 371223496 3.130000e-17 100.0
15 TraesCS3B01G007600 chr4D 86.047 129 16 1 25 153 218362682 218362808 2.380000e-28 137.0
16 TraesCS3B01G007600 chr7B 82.031 128 21 1 26 153 146717469 146717594 1.870000e-19 108.0
17 TraesCS3B01G007600 chr1D 80.952 126 23 1 19 144 343289173 343289297 1.130000e-16 99.0
18 TraesCS3B01G007600 chr2A 81.982 111 20 0 25 135 50314665 50314555 1.460000e-15 95.3
19 TraesCS3B01G007600 chr2B 79.675 123 21 3 19 139 586764990 586764870 8.760000e-13 86.1
20 TraesCS3B01G007600 chr6A 74.272 206 35 15 398 591 17302626 17302825 2.450000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G007600 chr3B 3892702 3897612 4910 False 9070.000000 9070 100.000000 1 4911 1 chr3B.!!$F1 4910
1 TraesCS3B01G007600 chr3B 4779628 4784538 4910 False 8981.000000 8981 99.674000 1 4911 1 chr3B.!!$F2 4910
2 TraesCS3B01G007600 chr3A 7276278 7280348 4070 True 1703.000000 2822 89.760667 878 4911 3 chr3A.!!$R1 4033
3 TraesCS3B01G007600 chr3D 1743719 1747427 3708 False 2518.000000 2771 91.374000 877 4911 2 chr3D.!!$F1 4034
4 TraesCS3B01G007600 chr7A 21355337 21359889 4552 True 516.666667 743 83.786333 1018 3513 3 chr7A.!!$R1 2495
5 TraesCS3B01G007600 chr4A 669234991 669235582 591 False 577.000000 577 84.288000 1004 1611 1 chr4A.!!$F1 607
6 TraesCS3B01G007600 chr7D 21008505 21009083 578 True 542.000000 542 83.636000 1013 1614 1 chr7D.!!$R1 601

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
241 242 3.089284 TCTCACTTATCACCTTCAGCGA 58.911 45.455 0.0 0.0 0.0 4.93 F
521 522 6.072230 TGTTCGGAAAATGATAAATGCTCACA 60.072 34.615 0.0 0.0 0.0 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1978 2072 1.982395 TCGATCAGCTTCACCCGGT 60.982 57.895 0.0 0.0 0.0 5.28 R
4782 6452 0.455633 CACGTCGTCTTTCCCTACCG 60.456 60.000 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 242 3.089284 TCTCACTTATCACCTTCAGCGA 58.911 45.455 0.00 0.0 0.00 4.93
521 522 6.072230 TGTTCGGAAAATGATAAATGCTCACA 60.072 34.615 0.00 0.0 0.00 3.58
1978 2072 2.099405 TGTGTATGTGAGAGCCGATGA 58.901 47.619 0.00 0.0 0.00 2.92
4782 6452 4.754667 GCTCCGTCGGGTTGGGTC 62.755 72.222 12.29 0.0 33.83 4.46
4798 6468 3.710106 GTCGGTAGGGAAAGACGAC 57.290 57.895 0.00 0.0 45.42 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 242 6.072649 GCTTATAGAGAGACCTAGAAACCCT 58.927 44.000 0.00 0.0 0.00 4.34
345 346 0.916086 TCCCGAATAACACATGGGCT 59.084 50.000 0.00 0.0 39.82 5.19
773 775 7.678837 TCTTCATTGAATTACAAAAATGGCCT 58.321 30.769 3.32 0.0 42.03 5.19
1978 2072 1.982395 TCGATCAGCTTCACCCGGT 60.982 57.895 0.00 0.0 0.00 5.28
4782 6452 0.455633 CACGTCGTCTTTCCCTACCG 60.456 60.000 0.00 0.0 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.