Multiple sequence alignment - TraesCS3B01G007300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G007300 chr3B 100.000 3509 0 0 1 3509 3804269 3807777 0.000000e+00 6481.0
1 TraesCS3B01G007300 chr3B 99.003 3511 33 2 1 3509 4702747 4706257 0.000000e+00 6288.0
2 TraesCS3B01G007300 chr3A 90.948 2773 224 21 359 3119 7386930 7384173 0.000000e+00 3705.0
3 TraesCS3B01G007300 chr3A 89.365 1796 160 16 967 2740 7312804 7311018 0.000000e+00 2230.0
4 TraesCS3B01G007300 chr3A 92.696 753 37 7 2771 3509 7311018 7310270 0.000000e+00 1070.0
5 TraesCS3B01G007300 chr3A 86.053 380 32 18 1 367 7388208 7387837 4.250000e-104 388.0
6 TraesCS3B01G007300 chr3A 82.090 402 41 21 3129 3502 7363909 7363511 7.310000e-82 315.0
7 TraesCS3B01G007300 chr3A 88.430 121 9 4 1 117 7314181 7314062 1.310000e-29 141.0
8 TraesCS3B01G007300 chr3D 93.580 2134 126 6 1193 3322 1658122 1660248 0.000000e+00 3171.0
9 TraesCS3B01G007300 chr3D 85.673 342 33 7 3180 3507 1647733 1648072 2.590000e-91 346.0
10 TraesCS3B01G007300 chr3D 96.842 190 6 0 3320 3509 1660490 1660679 5.650000e-83 318.0
11 TraesCS3B01G007300 chr3D 92.473 93 7 0 1 93 1656802 1656894 2.200000e-27 134.0
12 TraesCS3B01G007300 chr3D 95.000 60 3 0 1993 2052 1708269 1708328 1.040000e-15 95.3
13 TraesCS3B01G007300 chr6A 79.923 1041 173 25 1359 2384 574526098 574525079 0.000000e+00 732.0
14 TraesCS3B01G007300 chr6B 79.406 1010 172 29 1359 2353 646742445 646741457 0.000000e+00 680.0
15 TraesCS3B01G007300 chr4B 75.540 278 58 8 2689 2960 434599605 434599878 1.020000e-25 128.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G007300 chr3B 3804269 3807777 3508 False 6481.000000 6481 100.000000 1 3509 1 chr3B.!!$F1 3508
1 TraesCS3B01G007300 chr3B 4702747 4706257 3510 False 6288.000000 6288 99.003000 1 3509 1 chr3B.!!$F2 3508
2 TraesCS3B01G007300 chr3A 7384173 7388208 4035 True 2046.500000 3705 88.500500 1 3119 2 chr3A.!!$R3 3118
3 TraesCS3B01G007300 chr3A 7310270 7314181 3911 True 1147.000000 2230 90.163667 1 3509 3 chr3A.!!$R2 3508
4 TraesCS3B01G007300 chr3D 1656802 1660679 3877 False 1207.666667 3171 94.298333 1 3509 3 chr3D.!!$F3 3508
5 TraesCS3B01G007300 chr6A 574525079 574526098 1019 True 732.000000 732 79.923000 1359 2384 1 chr6A.!!$R1 1025
6 TraesCS3B01G007300 chr6B 646741457 646742445 988 True 680.000000 680 79.406000 1359 2353 1 chr6B.!!$R1 994

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1152 3032 3.541632 TGGTATTGGAGAAAATCTCGGC 58.458 45.455 1.58 0.0 44.28 5.54 F
2077 4273 2.565834 GTTGACCCAGAGTACCTGCTTA 59.434 50.000 5.98 0.0 41.57 3.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2086 4282 0.529119 ACGTCGTTCTTGTGGGTGAC 60.529 55.000 0.0 0.0 0.0 3.67 R
3470 5949 3.460103 TCACTACTTGTTTTCGGTCCAC 58.540 45.455 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1152 3032 3.541632 TGGTATTGGAGAAAATCTCGGC 58.458 45.455 1.58 0.00 44.28 5.54
1427 3617 7.773224 TCACAAAAGGAGTATCAAAAGACAAGA 59.227 33.333 0.00 0.00 36.25 3.02
1465 3655 4.025229 GTGACGAATACTTTCAACAGCACA 60.025 41.667 0.00 0.00 0.00 4.57
1544 3740 2.902846 CCGAGGAGCGATCGAGGT 60.903 66.667 21.57 1.32 44.57 3.85
1634 3830 3.479269 CGACGTCGAAGGCAAGGC 61.479 66.667 33.35 0.00 43.02 4.35
2077 4273 2.565834 GTTGACCCAGAGTACCTGCTTA 59.434 50.000 5.98 0.00 41.57 3.09
2108 4304 0.249322 ACCCACAAGAACGACGTCTG 60.249 55.000 14.70 9.79 0.00 3.51
2481 4677 5.010112 GGTTTTTAGCCTTGAGAAGAAAGCT 59.990 40.000 0.00 0.00 0.00 3.74
3186 5417 9.411801 CATAGTTCAGATTAAGTATACACGCAT 57.588 33.333 5.50 0.00 0.00 4.73
3470 5949 6.603237 TTGGTGTCTGCGAAGATTATAATG 57.397 37.500 1.78 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1215 3388 8.081633 TGAAATTAAAGACACTGCTTTGGTATG 58.918 33.333 0.00 0.0 38.47 2.39
1222 3399 9.289782 ACTAAGATGAAATTAAAGACACTGCTT 57.710 29.630 0.00 0.0 0.00 3.91
1427 3617 6.707440 ATTCGTCACTCTGTCTAATCAGAT 57.293 37.500 0.00 0.0 42.47 2.90
1465 3655 2.836636 TCTGACAGTATCTGGCCTCT 57.163 50.000 3.32 0.0 39.07 3.69
1544 3740 2.269172 TGTCGAACACGTTTGTTGCTA 58.731 42.857 0.00 0.0 46.43 3.49
2086 4282 0.529119 ACGTCGTTCTTGTGGGTGAC 60.529 55.000 0.00 0.0 0.00 3.67
2108 4304 2.361737 GGAGGACCCCAAAGCTGC 60.362 66.667 0.00 0.0 0.00 5.25
3186 5417 5.164620 TCTGAGCCACACTTTTCATATGA 57.835 39.130 0.00 0.0 0.00 2.15
3470 5949 3.460103 TCACTACTTGTTTTCGGTCCAC 58.540 45.455 0.00 0.0 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.