Multiple sequence alignment - TraesCS3B01G007100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G007100 chr3B 100.000 2876 0 0 1 2876 3665058 3662183 0.000000e+00 5312.0
1 TraesCS3B01G007100 chr3B 99.653 2017 7 0 860 2876 5172107 5174123 0.000000e+00 3687.0
2 TraesCS3B01G007100 chr3B 98.051 821 10 3 1 815 5171291 5172111 0.000000e+00 1423.0
3 TraesCS3B01G007100 chr3A 92.006 2089 131 10 815 2876 7472849 7470770 0.000000e+00 2900.0
4 TraesCS3B01G007100 chr3A 91.206 796 30 12 1 773 7474623 7473845 0.000000e+00 1046.0
5 TraesCS3B01G007100 chr3A 92.727 55 4 0 751 805 7473837 7473783 2.380000e-11 80.5
6 TraesCS3B01G007100 chr3D 91.098 2067 151 20 815 2876 1636890 1634852 0.000000e+00 2767.0
7 TraesCS3B01G007100 chrUn 100.000 79 0 0 2798 2876 480652057 480652135 2.310000e-31 147.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G007100 chr3B 3662183 3665058 2875 True 5312.000000 5312 100.000000 1 2876 1 chr3B.!!$R1 2875
1 TraesCS3B01G007100 chr3B 5171291 5174123 2832 False 2555.000000 3687 98.852000 1 2876 2 chr3B.!!$F1 2875
2 TraesCS3B01G007100 chr3A 7470770 7474623 3853 True 1342.166667 2900 91.979667 1 2876 3 chr3A.!!$R1 2875
3 TraesCS3B01G007100 chr3D 1634852 1636890 2038 True 2767.000000 2767 91.098000 815 2876 1 chr3D.!!$R1 2061

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 558 2.351726 GACCAAAGTGTATAAGCTGCCG 59.648 50.0 0.0 0.0 0.0 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2106 3162 2.276869 TGTCTCAGGGATGACACCG 58.723 57.895 0.0 0.0 38.15 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 7.277174 ACAGTTAATTTTTCTCCTTCAGTGG 57.723 36.000 0.00 0.00 0.00 4.00
186 187 3.051940 TCTCCTTCAGTGGGCTATGAT 57.948 47.619 0.00 0.00 0.00 2.45
187 188 4.199002 TCTCCTTCAGTGGGCTATGATA 57.801 45.455 0.00 0.00 0.00 2.15
188 189 4.155709 TCTCCTTCAGTGGGCTATGATAG 58.844 47.826 0.00 0.00 0.00 2.08
189 190 3.242867 TCCTTCAGTGGGCTATGATAGG 58.757 50.000 1.11 0.00 0.00 2.57
214 221 9.448294 GGTAGTATCTTATCTTTGTCAACTACG 57.552 37.037 0.00 0.00 38.30 3.51
534 558 2.351726 GACCAAAGTGTATAAGCTGCCG 59.648 50.000 0.00 0.00 0.00 5.69
811 865 7.273381 GCAGTAGGTGTTTGTAATTGCAATTAG 59.727 37.037 28.00 14.55 31.94 1.73
2041 3097 5.134339 TCTTCCAATAAACTAGATGGGCCAT 59.866 40.000 21.39 21.39 33.66 4.40
2106 3162 7.771183 TGCTAATTTCATCAAATAACCTGTCC 58.229 34.615 0.00 0.00 31.51 4.02
2414 3473 0.459489 GCAGTGGAGTCCTAGAGCTG 59.541 60.000 11.33 11.29 0.00 4.24
2765 3824 3.308473 GGACAAGGGGAGCATAAAAGAGT 60.308 47.826 0.00 0.00 0.00 3.24
2796 3855 3.638160 AGAATGCAAAGCTTTGAGGAACA 59.362 39.130 37.14 25.80 40.55 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 4.042809 TCATAGCCCACTGAAGGAGAAAAA 59.957 41.667 0.00 0.00 0.00 1.94
170 171 4.835615 ACTACCTATCATAGCCCACTGAAG 59.164 45.833 0.00 0.00 0.00 3.02
188 189 9.448294 CGTAGTTGACAAAGATAAGATACTACC 57.552 37.037 0.00 0.00 34.65 3.18
214 221 0.933097 CATGATGTGGCGCTGTAGTC 59.067 55.000 7.64 0.16 0.00 2.59
534 558 1.866853 CGCTTTGGTTGGAGAAGGGC 61.867 60.000 0.00 0.00 0.00 5.19
811 865 3.326297 AGGAGATATTTGCCCTGCTAGAC 59.674 47.826 0.00 0.00 0.00 2.59
2106 3162 2.276869 TGTCTCAGGGATGACACCG 58.723 57.895 0.00 0.00 38.15 4.94
2765 3824 4.859304 AGCTTTGCATTCTGTGATGAAA 57.141 36.364 0.00 0.00 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.