Multiple sequence alignment - TraesCS3B01G006900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G006900 chr3B 100.000 3465 0 0 1 3465 3638061 3634597 0.000000e+00 6399
1 TraesCS3B01G006900 chr3B 99.328 1934 10 2 1 1931 5198430 5200363 0.000000e+00 3496
2 TraesCS3B01G006900 chr3B 97.103 1519 16 3 1947 3465 5200462 5201952 0.000000e+00 2536
3 TraesCS3B01G006900 chr3D 93.488 1858 94 15 1 1854 1609486 1607652 0.000000e+00 2736
4 TraesCS3B01G006900 chr3D 91.696 843 29 16 1949 2762 1607348 1606518 0.000000e+00 1131
5 TraesCS3B01G006900 chr3A 92.318 1510 66 20 350 1851 7439372 7437905 0.000000e+00 2100
6 TraesCS3B01G006900 chr3A 82.849 1341 119 37 1977 3256 7436115 7434825 0.000000e+00 1099
7 TraesCS3B01G006900 chr3A 88.312 847 55 24 1947 2768 7437652 7436825 0.000000e+00 976
8 TraesCS3B01G006900 chr3A 87.744 359 28 8 1 345 7439817 7439461 4.160000e-109 405
9 TraesCS3B01G006900 chr3A 82.270 141 25 0 2109 2249 11838438 11838298 4.700000e-24 122
10 TraesCS3B01G006900 chr3A 91.667 72 5 1 1861 1931 7437824 7437753 7.910000e-17 99
11 TraesCS3B01G006900 chr7D 88.329 694 75 3 1121 1811 272591467 272592157 0.000000e+00 828
12 TraesCS3B01G006900 chr7D 85.568 783 49 34 1952 2689 272592669 272593432 0.000000e+00 761
13 TraesCS3B01G006900 chr7D 83.729 295 32 6 851 1132 272583212 272583503 7.370000e-67 265
14 TraesCS3B01G006900 chr7D 81.915 188 25 5 424 606 272582903 272583086 2.150000e-32 150
15 TraesCS3B01G006900 chr7A 86.486 740 53 27 1961 2671 306221554 306222275 0.000000e+00 769
16 TraesCS3B01G006900 chr7A 88.213 526 56 2 1289 1811 306221003 306221525 1.060000e-174 623
17 TraesCS3B01G006900 chr7B 84.426 488 43 18 2232 2691 265471689 265471207 1.900000e-122 449
18 TraesCS3B01G006900 chr2A 90.062 322 29 3 3 324 613041448 613041766 6.920000e-112 414


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G006900 chr3B 3634597 3638061 3464 True 6399.0 6399 100.0000 1 3465 1 chr3B.!!$R1 3464
1 TraesCS3B01G006900 chr3B 5198430 5201952 3522 False 3016.0 3496 98.2155 1 3465 2 chr3B.!!$F1 3464
2 TraesCS3B01G006900 chr3D 1606518 1609486 2968 True 1933.5 2736 92.5920 1 2762 2 chr3D.!!$R1 2761
3 TraesCS3B01G006900 chr3A 7434825 7439817 4992 True 935.8 2100 88.5780 1 3256 5 chr3A.!!$R2 3255
4 TraesCS3B01G006900 chr7D 272591467 272593432 1965 False 794.5 828 86.9485 1121 2689 2 chr7D.!!$F2 1568
5 TraesCS3B01G006900 chr7D 272582903 272583503 600 False 207.5 265 82.8220 424 1132 2 chr7D.!!$F1 708
6 TraesCS3B01G006900 chr7A 306221003 306222275 1272 False 696.0 769 87.3495 1289 2671 2 chr7A.!!$F1 1382

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1536 1667 2.248431 GACAAGCCGTCGTTGCAC 59.752 61.111 0.0 0.0 34.19 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3261 5504 2.242043 CCAACAATTGTCTTCCTGGCT 58.758 47.619 12.39 0.0 0.0 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1536 1667 2.248431 GACAAGCCGTCGTTGCAC 59.752 61.111 0.00 0.00 34.19 4.57
1859 2113 6.711579 TCGCAGTTAAGAGTTAGTTGTTTTG 58.288 36.000 0.00 0.00 0.00 2.44
1984 2630 3.228453 GGAAGGCATGATGATCCATGTT 58.772 45.455 11.95 2.11 44.25 2.71
2188 2850 2.281208 GTGTACCAGCCCGTGCAA 60.281 61.111 0.00 0.00 41.13 4.08
2825 5051 0.234625 GCTTCGCATCGACACAAACA 59.765 50.000 0.00 0.00 34.89 2.83
3037 5263 1.202582 CTCCTCACACACCGGTTCTAG 59.797 57.143 2.97 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1566 1700 1.674057 CGTCCAGTTCTTGCCCTCT 59.326 57.895 0.00 0.00 0.00 3.69
1859 2113 0.109226 GCACCACAGACGGAGAGTAC 60.109 60.000 0.00 0.00 0.00 2.73
2128 2790 0.176680 GGTCGATGCACCAGATCTGT 59.823 55.000 21.11 6.95 36.32 3.41
2806 5032 5.723275 ACATGTTTGTGTCGATGCGAAGC 62.723 47.826 0.00 0.00 45.61 3.86
2825 5051 3.083997 GAGGAGGACCCGCCACAT 61.084 66.667 11.38 0.00 40.87 3.21
2970 5196 5.520632 GTTTGCCTTTTGACTAGGTTCTTC 58.479 41.667 0.00 0.00 35.13 2.87
3037 5263 8.549338 AGGTTCAAGTTACAAGAGTTATAAGC 57.451 34.615 0.00 0.00 0.00 3.09
3261 5504 2.242043 CCAACAATTGTCTTCCTGGCT 58.758 47.619 12.39 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.