Multiple sequence alignment - TraesCS3B01G006800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G006800 chr3B 100.000 2547 0 0 1 2547 3630150 3627604 0.000000e+00 4704.0
1 TraesCS3B01G006800 chr3B 97.222 1656 6 2 1 1656 5206236 5207851 0.000000e+00 2767.0
2 TraesCS3B01G006800 chr3B 98.442 642 5 1 1634 2270 5207882 5208523 0.000000e+00 1125.0
3 TraesCS3B01G006800 chr7D 90.432 648 58 4 1902 2547 490897691 490898336 0.000000e+00 850.0
4 TraesCS3B01G006800 chr7D 77.333 150 23 8 92 230 92445363 92445214 7.550000e-11 78.7
5 TraesCS3B01G006800 chrUn 89.628 646 65 2 1902 2547 94299997 94299354 0.000000e+00 821.0
6 TraesCS3B01G006800 chrUn 89.490 647 67 1 1902 2547 94264439 94263793 0.000000e+00 817.0
7 TraesCS3B01G006800 chr1A 89.385 650 65 1 1902 2547 521876464 521875815 0.000000e+00 815.0
8 TraesCS3B01G006800 chr2B 89.026 647 68 3 1902 2547 463345241 463345885 0.000000e+00 798.0
9 TraesCS3B01G006800 chr5A 89.026 647 62 7 1902 2547 74699959 74699321 0.000000e+00 793.0
10 TraesCS3B01G006800 chr5A 91.304 46 3 1 102 147 386465176 386465132 7.610000e-06 62.1
11 TraesCS3B01G006800 chr4D 89.026 647 62 5 1902 2547 13340146 13340784 0.000000e+00 793.0
12 TraesCS3B01G006800 chr1D 88.769 650 65 7 1902 2547 439000380 438999735 0.000000e+00 789.0
13 TraesCS3B01G006800 chr3D 89.179 536 47 6 1023 1558 1602971 1602447 0.000000e+00 658.0
14 TraesCS3B01G006800 chr3D 84.440 527 55 13 433 953 1603562 1603057 6.330000e-136 494.0
15 TraesCS3B01G006800 chr3D 87.715 407 39 6 1 403 1604150 1603751 4.960000e-127 464.0
16 TraesCS3B01G006800 chr3D 95.775 71 3 0 1647 1717 1593698 1593628 5.760000e-22 115.0
17 TraesCS3B01G006800 chr3D 79.487 117 16 4 65 176 560352430 560352317 2.720000e-10 76.8
18 TraesCS3B01G006800 chr3A 88.180 533 52 6 1023 1555 7432767 7432246 2.150000e-175 625.0
19 TraesCS3B01G006800 chr3A 83.130 492 63 14 415 899 7433388 7432910 5.030000e-117 431.0
20 TraesCS3B01G006800 chr5D 84.524 84 12 1 105 187 232286538 232286455 5.840000e-12 82.4
21 TraesCS3B01G006800 chr6B 91.228 57 3 1 93 147 685357429 685357373 2.720000e-10 76.8
22 TraesCS3B01G006800 chr7A 94.444 36 1 1 110 144 721217585 721217620 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G006800 chr3B 3627604 3630150 2546 True 4704.000000 4704 100.000000 1 2547 1 chr3B.!!$R1 2546
1 TraesCS3B01G006800 chr3B 5206236 5208523 2287 False 1946.000000 2767 97.832000 1 2270 2 chr3B.!!$F1 2269
2 TraesCS3B01G006800 chr7D 490897691 490898336 645 False 850.000000 850 90.432000 1902 2547 1 chr7D.!!$F1 645
3 TraesCS3B01G006800 chrUn 94299354 94299997 643 True 821.000000 821 89.628000 1902 2547 1 chrUn.!!$R2 645
4 TraesCS3B01G006800 chrUn 94263793 94264439 646 True 817.000000 817 89.490000 1902 2547 1 chrUn.!!$R1 645
5 TraesCS3B01G006800 chr1A 521875815 521876464 649 True 815.000000 815 89.385000 1902 2547 1 chr1A.!!$R1 645
6 TraesCS3B01G006800 chr2B 463345241 463345885 644 False 798.000000 798 89.026000 1902 2547 1 chr2B.!!$F1 645
7 TraesCS3B01G006800 chr5A 74699321 74699959 638 True 793.000000 793 89.026000 1902 2547 1 chr5A.!!$R1 645
8 TraesCS3B01G006800 chr4D 13340146 13340784 638 False 793.000000 793 89.026000 1902 2547 1 chr4D.!!$F1 645
9 TraesCS3B01G006800 chr1D 438999735 439000380 645 True 789.000000 789 88.769000 1902 2547 1 chr1D.!!$R1 645
10 TraesCS3B01G006800 chr3D 1602447 1604150 1703 True 538.666667 658 87.111333 1 1558 3 chr3D.!!$R3 1557
11 TraesCS3B01G006800 chr3A 7432246 7433388 1142 True 528.000000 625 85.655000 415 1555 2 chr3A.!!$R1 1140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 632 2.808543 GCAGAAGGTCGTGAGTTTGAAT 59.191 45.455 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2432 2745 1.269465 CGATGATCACCTCGATGCAGT 60.269 52.381 12.36 0.0 36.54 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 632 2.808543 GCAGAAGGTCGTGAGTTTGAAT 59.191 45.455 0.00 0.0 0.00 2.57
952 1135 4.489795 CAGATCGTGCGTGCGTGC 62.490 66.667 1.25 0.0 0.00 5.34
2293 2603 3.307199 CCCCTGCTTTCGTAGGAGTTTTA 60.307 47.826 0.00 0.0 44.96 1.52
2359 2669 4.511246 AGGGGATACGACCGCCGA 62.511 66.667 0.00 0.0 42.68 5.54
2432 2745 3.927817 TAGCCGCCAACCACCCCTA 62.928 63.158 0.00 0.0 0.00 3.53
2525 2838 4.102210 AGGTATGGACAGTGGAGATGAATG 59.898 45.833 0.00 0.0 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 632 3.311110 AAGGTGCGCGAGGAGGAA 61.311 61.111 12.10 0.00 0.00 3.36
953 1136 1.437089 CTTATATGCACGCACGCGC 60.437 57.895 12.02 0.00 44.19 6.86
954 1137 1.437089 GCTTATATGCACGCACGCG 60.437 57.895 10.36 10.36 46.03 6.01
955 1138 1.082756 GGCTTATATGCACGCACGC 60.083 57.895 12.22 0.00 34.04 5.34
956 1139 1.201578 CGGCTTATATGCACGCACG 59.798 57.895 12.22 3.02 34.04 5.34
957 1140 1.082756 GCGGCTTATATGCACGCAC 60.083 57.895 26.40 10.20 45.09 5.34
958 1141 2.594048 CGCGGCTTATATGCACGCA 61.594 57.895 28.37 0.00 45.59 5.24
959 1142 2.170985 CGCGGCTTATATGCACGC 59.829 61.111 23.84 23.84 43.62 5.34
960 1143 2.853210 CCGCGGCTTATATGCACG 59.147 61.111 14.67 13.51 35.04 5.34
961 1144 2.556287 GCCGCGGCTTATATGCAC 59.444 61.111 41.71 9.84 38.26 4.57
962 1145 2.668212 GGCCGCGGCTTATATGCA 60.668 61.111 45.23 0.00 41.60 3.96
963 1146 2.668212 TGGCCGCGGCTTATATGC 60.668 61.111 45.23 28.87 41.60 3.14
1282 1528 2.690881 ACCATCCTGGCCGCCTTA 60.691 61.111 11.61 0.00 42.67 2.69
2274 2584 3.371285 GGCTAAAACTCCTACGAAAGCAG 59.629 47.826 0.00 0.00 0.00 4.24
2359 2669 1.731433 CCGTGGTCCATATCCGTCGT 61.731 60.000 0.00 0.00 0.00 4.34
2432 2745 1.269465 CGATGATCACCTCGATGCAGT 60.269 52.381 12.36 0.00 36.54 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.