Multiple sequence alignment - TraesCS3B01G006700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G006700 chr3B 100.000 4717 0 0 1 4717 3600468 3605184 0.000000e+00 8711.0
1 TraesCS3B01G006700 chr3B 99.175 4730 8 7 1 4717 5235727 5231016 0.000000e+00 8492.0
2 TraesCS3B01G006700 chr3B 100.000 1449 0 0 5219 6667 3605686 3607134 0.000000e+00 2676.0
3 TraesCS3B01G006700 chr3B 99.586 1448 6 0 5220 6667 5230932 5229485 0.000000e+00 2641.0
4 TraesCS3B01G006700 chr3B 79.984 1289 220 22 1468 2745 13745560 13746821 0.000000e+00 917.0
5 TraesCS3B01G006700 chr3B 75.727 894 161 38 2180 3036 6671526 6670652 1.350000e-106 398.0
6 TraesCS3B01G006700 chr3B 88.889 279 25 4 1001 1274 13744992 13745269 8.280000e-89 339.0
7 TraesCS3B01G006700 chr3B 83.755 277 37 5 1001 1274 6672931 6672660 8.580000e-64 255.0
8 TraesCS3B01G006700 chr3B 85.909 220 25 4 6448 6664 534052606 534052390 5.200000e-56 230.0
9 TraesCS3B01G006700 chr3B 81.053 95 15 2 308 401 62708160 62708068 9.270000e-09 73.1
10 TraesCS3B01G006700 chr3B 97.436 39 1 0 367 405 64937495 64937533 4.310000e-07 67.6
11 TraesCS3B01G006700 chr3A 79.811 1585 281 28 1466 3019 11027613 11026037 0.000000e+00 1118.0
12 TraesCS3B01G006700 chr3A 79.301 1546 272 32 1510 3019 11071642 11070109 0.000000e+00 1038.0
13 TraesCS3B01G006700 chr3A 79.552 983 188 10 1510 2488 11065433 11064460 0.000000e+00 689.0
14 TraesCS3B01G006700 chr3A 75.444 900 169 36 2172 3036 9844834 9843952 2.250000e-104 390.0
15 TraesCS3B01G006700 chr3A 77.673 636 118 16 1458 2078 9846129 9845503 3.800000e-97 366.0
16 TraesCS3B01G006700 chr3A 89.130 276 27 3 1001 1274 11066657 11066383 2.300000e-89 340.0
17 TraesCS3B01G006700 chr3A 89.130 276 27 3 1001 1274 11072866 11072592 2.300000e-89 340.0
18 TraesCS3B01G006700 chr3A 88.768 276 28 3 1001 1274 11028172 11027898 1.070000e-87 335.0
19 TraesCS3B01G006700 chr3A 85.036 274 38 3 2474 2745 11059137 11058865 6.590000e-70 276.0
20 TraesCS3B01G006700 chr3A 82.392 301 44 7 977 1274 9846518 9846224 3.090000e-63 254.0
21 TraesCS3B01G006700 chr3A 85.520 221 30 2 6448 6667 626012429 626012648 5.200000e-56 230.0
22 TraesCS3B01G006700 chr3A 92.784 97 7 0 6347 6443 694361672 694361576 2.510000e-29 141.0
23 TraesCS3B01G006700 chr3A 91.566 83 7 0 6361 6443 5544090 5544172 1.520000e-21 115.0
24 TraesCS3B01G006700 chrUn 100.000 413 0 0 6185 6597 477452383 477452795 0.000000e+00 763.0
25 TraesCS3B01G006700 chrUn 75.425 883 180 25 2179 3035 35628602 35629473 1.740000e-105 394.0
26 TraesCS3B01G006700 chrUn 76.621 663 136 16 1458 2105 327485191 327484533 1.380000e-91 348.0
27 TraesCS3B01G006700 chrUn 95.238 63 3 0 6287 6349 334603542 334603480 4.250000e-17 100.0
28 TraesCS3B01G006700 chr3D 88.929 280 23 6 1 278 1380714 1380987 8.280000e-89 339.0
29 TraesCS3B01G006700 chr3D 76.656 634 119 21 1458 2078 4182574 4181957 2.320000e-84 324.0
30 TraesCS3B01G006700 chr3D 92.093 215 17 0 6071 6285 1488550 1488764 3.020000e-78 303.0
31 TraesCS3B01G006700 chr3D 91.284 218 17 1 6450 6667 1489901 1490116 5.060000e-76 296.0
32 TraesCS3B01G006700 chr3D 81.879 298 50 3 977 1274 4182963 4182670 1.440000e-61 248.0
33 TraesCS3B01G006700 chr3D 77.824 239 50 3 2801 3037 4180637 4180400 1.940000e-30 145.0
34 TraesCS3B01G006700 chr3D 88.660 97 11 0 6347 6443 72551296 72551200 1.170000e-22 119.0
35 TraesCS3B01G006700 chr3D 95.238 63 2 1 6287 6349 1489835 1489896 1.530000e-16 99.0
36 TraesCS3B01G006700 chr7A 86.301 219 27 3 6450 6667 511728427 511728211 1.120000e-57 235.0
37 TraesCS3B01G006700 chr7A 95.238 63 3 0 6287 6349 726590837 726590775 4.250000e-17 100.0
38 TraesCS3B01G006700 chr4D 85.973 221 29 2 6448 6667 403280939 403281158 1.120000e-57 235.0
39 TraesCS3B01G006700 chr4D 85.068 221 31 2 6448 6667 368421393 368421174 2.420000e-54 224.0
40 TraesCS3B01G006700 chr4D 93.662 142 6 1 3995 4136 28103877 28103739 6.770000e-50 209.0
41 TraesCS3B01G006700 chr4B 95.804 143 4 2 3995 4136 54291412 54291553 5.200000e-56 230.0
42 TraesCS3B01G006700 chr4B 93.651 63 2 2 6287 6349 437168362 437168422 7.120000e-15 93.5
43 TraesCS3B01G006700 chr7D 85.388 219 31 1 6448 6666 578683110 578683327 6.730000e-55 226.0
44 TraesCS3B01G006700 chr7D 90.722 97 8 1 6347 6443 467048582 467048677 1.950000e-25 128.0
45 TraesCS3B01G006700 chr7D 81.731 104 16 2 301 404 622606847 622606747 4.280000e-12 84.2
46 TraesCS3B01G006700 chr7D 100.000 30 0 0 372 401 53529154 53529125 1.000000e-03 56.5
47 TraesCS3B01G006700 chr5D 94.558 147 5 1 3994 4140 448096818 448096675 2.420000e-54 224.0
48 TraesCS3B01G006700 chr1D 94.406 143 7 1 3995 4137 259665794 259665935 1.130000e-52 219.0
49 TraesCS3B01G006700 chr1D 80.583 103 17 2 307 409 450612412 450612313 7.170000e-10 76.8
50 TraesCS3B01G006700 chr1D 94.872 39 2 0 367 405 265100228 265100190 2.010000e-05 62.1
51 TraesCS3B01G006700 chr2B 93.793 145 6 1 3995 4136 356544665 356544809 1.460000e-51 215.0
52 TraesCS3B01G006700 chr2B 92.784 97 7 0 6347 6443 310028774 310028678 2.510000e-29 141.0
53 TraesCS3B01G006700 chr6D 91.549 142 11 1 3995 4136 342877901 342878041 1.900000e-45 195.0
54 TraesCS3B01G006700 chr6D 92.784 97 7 0 6347 6443 168780679 168780775 2.510000e-29 141.0
55 TraesCS3B01G006700 chr5B 91.156 147 6 3 3995 4140 578545885 578545745 6.820000e-45 193.0
56 TraesCS3B01G006700 chr5B 84.000 100 14 2 301 400 376023487 376023584 1.980000e-15 95.3
57 TraesCS3B01G006700 chr2D 90.132 152 8 3 3998 4144 235074601 235074452 2.450000e-44 191.0
58 TraesCS3B01G006700 chr2D 82.105 95 15 1 307 401 62963213 62963121 5.540000e-11 80.5
59 TraesCS3B01G006700 chr2D 83.784 74 9 2 333 405 643675552 643675623 4.310000e-07 67.6
60 TraesCS3B01G006700 chr6B 93.814 97 6 0 6347 6443 388018389 388018485 5.390000e-31 147.0
61 TraesCS3B01G006700 chr6B 96.667 60 1 1 6291 6349 575009651 575009710 1.530000e-16 99.0
62 TraesCS3B01G006700 chr5A 96.667 60 1 1 6290 6349 631376140 631376082 1.530000e-16 99.0
63 TraesCS3B01G006700 chr5A 84.211 95 13 1 307 401 441162250 441162342 2.560000e-14 91.6
64 TraesCS3B01G006700 chr1B 93.548 62 4 0 6290 6351 460499252 460499191 7.120000e-15 93.5
65 TraesCS3B01G006700 chr1B 100.000 35 0 0 367 401 537531008 537531042 1.550000e-06 65.8
66 TraesCS3B01G006700 chr4A 81.416 113 17 4 307 417 511828114 511828004 9.210000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G006700 chr3B 3600468 3607134 6666 False 5693.500000 8711 100.000000 1 6667 2 chr3B.!!$F2 6666
1 TraesCS3B01G006700 chr3B 5229485 5235727 6242 True 5566.500000 8492 99.380500 1 6667 2 chr3B.!!$R3 6666
2 TraesCS3B01G006700 chr3B 13744992 13746821 1829 False 628.000000 917 84.436500 1001 2745 2 chr3B.!!$F3 1744
3 TraesCS3B01G006700 chr3B 6670652 6672931 2279 True 326.500000 398 79.741000 1001 3036 2 chr3B.!!$R4 2035
4 TraesCS3B01G006700 chr3A 11026037 11028172 2135 True 726.500000 1118 84.289500 1001 3019 2 chr3A.!!$R4 2018
5 TraesCS3B01G006700 chr3A 11064460 11072866 8406 True 601.750000 1038 84.278250 1001 3019 4 chr3A.!!$R5 2018
6 TraesCS3B01G006700 chr3A 9843952 9846518 2566 True 336.666667 390 78.503000 977 3036 3 chr3A.!!$R3 2059
7 TraesCS3B01G006700 chrUn 35628602 35629473 871 False 394.000000 394 75.425000 2179 3035 1 chrUn.!!$F1 856
8 TraesCS3B01G006700 chrUn 327484533 327485191 658 True 348.000000 348 76.621000 1458 2105 1 chrUn.!!$R1 647
9 TraesCS3B01G006700 chr3D 4180400 4182963 2563 True 239.000000 324 78.786333 977 3037 3 chr3D.!!$R2 2060
10 TraesCS3B01G006700 chr3D 1488550 1490116 1566 False 232.666667 303 92.871667 6071 6667 3 chr3D.!!$F2 596

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
230 231 1.884235 AACGGCTCAAAAGAGACCAG 58.116 50.000 0.0 0.0 0.0 4.00 F
391 392 3.244770 TGTCCTCCTAACCATTCAACCAC 60.245 47.826 0.0 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4186 6164 1.003696 GCCTAAGCCTTCTTGTCCTGT 59.996 52.381 0.00 0.0 33.85 4.00 R
6012 10071 8.084985 TCTCCTTTTCCAAAAATTAGGTTTGT 57.915 30.769 1.54 0.0 34.75 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
230 231 1.884235 AACGGCTCAAAAGAGACCAG 58.116 50.000 0.0 0.0 0.0 4.00
326 327 7.233632 TCTAGGAATAATGCAAGCACCAATAT 58.766 34.615 0.0 0.0 0.0 1.28
391 392 3.244770 TGTCCTCCTAACCATTCAACCAC 60.245 47.826 0.0 0.0 0.0 4.16
629 630 5.659079 ACTCAAGGGATTGTAACACCAAAAA 59.341 36.000 0.0 0.0 0.0 1.94
630 631 5.908341 TCAAGGGATTGTAACACCAAAAAC 58.092 37.500 0.0 0.0 0.0 2.43
631 632 5.659079 TCAAGGGATTGTAACACCAAAAACT 59.341 36.000 0.0 0.0 0.0 2.66
632 633 5.784578 AGGGATTGTAACACCAAAAACTC 57.215 39.130 0.0 0.0 0.0 3.01
633 634 5.454966 AGGGATTGTAACACCAAAAACTCT 58.545 37.500 0.0 0.0 0.0 3.24
634 635 6.607019 AGGGATTGTAACACCAAAAACTCTA 58.393 36.000 0.0 0.0 0.0 2.43
635 636 7.238710 AGGGATTGTAACACCAAAAACTCTAT 58.761 34.615 0.0 0.0 0.0 1.98
636 637 7.728532 AGGGATTGTAACACCAAAAACTCTATT 59.271 33.333 0.0 0.0 0.0 1.73
637 638 8.027189 GGGATTGTAACACCAAAAACTCTATTC 58.973 37.037 0.0 0.0 0.0 1.75
638 639 8.793592 GGATTGTAACACCAAAAACTCTATTCT 58.206 33.333 0.0 0.0 0.0 2.40
5378 7356 9.661563 TCCTATTATAAAATATGCACCTTACCG 57.338 33.333 0.0 0.0 0.0 4.02
6012 10071 4.358851 CACTCGCTTGAATTTCCACAAAA 58.641 39.130 0.0 0.0 0.0 2.44
6021 10080 7.065204 GCTTGAATTTCCACAAAACAAACCTAA 59.935 33.333 0.0 0.0 0.0 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
190 191 5.106157 CGTTTGCTTTCTAATCATTGGGACT 60.106 40.000 0.00 0.0 0.00 3.85
230 231 6.656003 AGTTGTTCTTTTACTAATGACGCAC 58.344 36.000 0.00 0.0 0.00 5.34
326 327 5.190528 AGCAGAATTCAAATCCTAGACCTGA 59.809 40.000 8.44 0.0 0.00 3.86
391 392 5.591099 AGTTTCTTACTGCAAACCAACATG 58.409 37.500 0.00 0.0 35.19 3.21
517 518 3.884774 ACCCGCAAGCACCCAGAA 61.885 61.111 0.00 0.0 0.00 3.02
518 519 4.641645 CACCCGCAAGCACCCAGA 62.642 66.667 0.00 0.0 0.00 3.86
4186 6164 1.003696 GCCTAAGCCTTCTTGTCCTGT 59.996 52.381 0.00 0.0 33.85 4.00
6012 10071 8.084985 TCTCCTTTTCCAAAAATTAGGTTTGT 57.915 30.769 1.54 0.0 34.75 2.83
6021 10080 6.998074 GGGTTTCAATCTCCTTTTCCAAAAAT 59.002 34.615 0.00 0.0 0.00 1.82
6099 10158 6.701841 TCTCATGTATATTTTTGCGAGACCTC 59.298 38.462 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.