Multiple sequence alignment - TraesCS3A01G532800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G532800 chr3A 100.000 2729 0 0 1 2729 745750330 745753058 0 5040
1 TraesCS3A01G532800 chr3A 97.217 2731 67 7 1 2729 711578029 711575306 0 4614
2 TraesCS3A01G532800 chr6A 97.657 2731 61 3 1 2729 494425300 494428029 0 4686
3 TraesCS3A01G532800 chr6A 97.183 2733 72 5 1 2729 554915088 554917819 0 4615
4 TraesCS3A01G532800 chr6A 96.376 2732 91 8 1 2729 531051976 531054702 0 4490
5 TraesCS3A01G532800 chr2A 97.541 2725 65 2 1 2724 733070589 733073312 0 4660
6 TraesCS3A01G532800 chr2A 97.327 2731 61 7 1 2729 58510412 58507692 0 4628
7 TraesCS3A01G532800 chr1A 97.145 2732 73 5 1 2729 21073548 21070819 0 4608
8 TraesCS3A01G532800 chr7A 96.451 2733 86 8 1 2729 675357138 675354413 0 4499
9 TraesCS3A01G532800 chr5A 96.268 2733 95 6 1 2729 33905187 33907916 0 4475


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G532800 chr3A 745750330 745753058 2728 False 5040 5040 100.000 1 2729 1 chr3A.!!$F1 2728
1 TraesCS3A01G532800 chr3A 711575306 711578029 2723 True 4614 4614 97.217 1 2729 1 chr3A.!!$R1 2728
2 TraesCS3A01G532800 chr6A 494425300 494428029 2729 False 4686 4686 97.657 1 2729 1 chr6A.!!$F1 2728
3 TraesCS3A01G532800 chr6A 554915088 554917819 2731 False 4615 4615 97.183 1 2729 1 chr6A.!!$F3 2728
4 TraesCS3A01G532800 chr6A 531051976 531054702 2726 False 4490 4490 96.376 1 2729 1 chr6A.!!$F2 2728
5 TraesCS3A01G532800 chr2A 733070589 733073312 2723 False 4660 4660 97.541 1 2724 1 chr2A.!!$F1 2723
6 TraesCS3A01G532800 chr2A 58507692 58510412 2720 True 4628 4628 97.327 1 2729 1 chr2A.!!$R1 2728
7 TraesCS3A01G532800 chr1A 21070819 21073548 2729 True 4608 4608 97.145 1 2729 1 chr1A.!!$R1 2728
8 TraesCS3A01G532800 chr7A 675354413 675357138 2725 True 4499 4499 96.451 1 2729 1 chr7A.!!$R1 2728
9 TraesCS3A01G532800 chr5A 33905187 33907916 2729 False 4475 4475 96.268 1 2729 1 chr5A.!!$F1 2728

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
977 985 1.418097 ATGTGCAGGGAGTGTGTGGA 61.418 55.0 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2543 2557 0.468226 TTCCTATGAAGGGCGCGAAT 59.532 50.0 12.1 0.0 43.84 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 36 7.486551 GCCAAGTAAACATGTATATTTCGCAAA 59.513 33.333 0.00 0.00 0.00 3.68
189 192 7.592885 ATTCTAGCCAACTGAATGCATTAAT 57.407 32.000 12.97 0.91 0.00 1.40
290 293 9.743057 CAACTAAAAACATTGAATGTCCAACTA 57.257 29.630 11.70 0.00 44.07 2.24
311 314 7.612065 ACTAGATATGTATGTTGGCCAAGTA 57.388 36.000 21.21 11.96 0.00 2.24
977 985 1.418097 ATGTGCAGGGAGTGTGTGGA 61.418 55.000 0.00 0.00 0.00 4.02
1662 1672 5.956642 ACTAGTAAGAAGAAGAAGAAGCGG 58.043 41.667 0.00 0.00 0.00 5.52
1724 1734 8.757982 AAAATATTGGTGAAGCTGATAGATGT 57.242 30.769 0.00 0.00 0.00 3.06
1726 1736 4.558226 TTGGTGAAGCTGATAGATGTGT 57.442 40.909 0.00 0.00 0.00 3.72
1768 1778 2.330440 TCATGACCACAATCATCCGG 57.670 50.000 0.00 0.00 37.20 5.14
1842 1852 5.694995 TCACCTGATGAAAAGGAGTTTCTT 58.305 37.500 0.00 0.00 45.14 2.52
2303 2317 3.004944 TCGGACCAAAGGCAATAACAAAC 59.995 43.478 0.00 0.00 0.00 2.93
2543 2557 6.939730 ACATGACCAACTTGTACAATATGTCA 59.060 34.615 21.94 21.94 35.57 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 36 6.942532 AAGTGTTCACTCACAAACATGTAT 57.057 33.333 0.00 0.00 40.37 2.29
91 93 6.686630 CATGTTTAGTTGGCCAGAAAACATA 58.313 36.000 32.58 19.57 44.62 2.29
138 141 2.435805 TCTCAGTTGGCCAGGATACATC 59.564 50.000 5.11 0.00 41.41 3.06
189 192 2.957680 ACATGCATGTTCAGTTGGACAA 59.042 40.909 26.61 0.00 37.90 3.18
290 293 6.247229 TGTACTTGGCCAACATACATATCT 57.753 37.500 24.60 0.76 0.00 1.98
301 304 2.591923 TGCATCTTTGTACTTGGCCAA 58.408 42.857 19.25 19.25 0.00 4.52
311 314 1.927487 TTGCCAGGATGCATCTTTGT 58.073 45.000 25.28 6.16 41.70 2.83
977 985 5.612725 TTTTTCCTTGTTCTTGGATGCTT 57.387 34.783 0.00 0.00 31.76 3.91
1190 1200 3.202906 GACTGCAAAGACACCACTACAA 58.797 45.455 0.00 0.00 0.00 2.41
1662 1672 3.122948 TCTGCTTTATTGTCTCGCGTTTC 59.877 43.478 5.77 0.00 0.00 2.78
1724 1734 2.213513 TGCGTCACCTCCCATCACA 61.214 57.895 0.00 0.00 0.00 3.58
1726 1736 1.480212 AAGTGCGTCACCTCCCATCA 61.480 55.000 6.39 0.00 34.49 3.07
1768 1778 4.798387 GGACAATGACAGTTTGTTCACAAC 59.202 41.667 0.00 0.00 37.43 3.32
1842 1852 4.503910 AGTTGCAGTTATACAAGATGCGA 58.496 39.130 0.00 0.00 39.74 5.10
1926 1937 5.477607 AGTACCATAACAGTTGCACACTA 57.522 39.130 0.00 0.00 32.76 2.74
2303 2317 5.535333 TCTCTACGGAAACTTGTACAAAGG 58.465 41.667 10.03 1.39 0.00 3.11
2480 2494 1.153628 GCAATCGTGGTACGCCTCT 60.154 57.895 0.00 0.00 42.21 3.69
2543 2557 0.468226 TTCCTATGAAGGGCGCGAAT 59.532 50.000 12.10 0.00 43.84 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.