Multiple sequence alignment - TraesCS3A01G532200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G532200 chr3A 100.000 3708 0 0 1 3708 745195434 745191727 0.000000e+00 6848.0
1 TraesCS3A01G532200 chr3A 99.434 3710 18 3 1 3708 745082231 745078523 0.000000e+00 6732.0
2 TraesCS3A01G532200 chr3A 98.023 3743 34 22 1 3708 745015451 745011714 0.000000e+00 6466.0
3 TraesCS3A01G532200 chr3A 97.191 3133 48 9 1 3098 744942524 744939397 0.000000e+00 5262.0
4 TraesCS3A01G532200 chr3A 83.420 2298 324 30 1439 3700 745298950 745296674 0.000000e+00 2080.0
5 TraesCS3A01G532200 chr3A 93.056 216 13 2 915 1128 745299444 745299229 7.730000e-82 315.0
6 TraesCS3A01G532200 chr3D 86.862 1941 237 14 1778 3706 610628384 610626450 0.000000e+00 2156.0
7 TraesCS3A01G532200 chr3D 81.116 1488 234 26 1528 3000 610668064 610666609 0.000000e+00 1147.0
8 TraesCS3A01G532200 chr3D 85.759 955 98 25 180 1125 610630159 610629234 0.000000e+00 976.0
9 TraesCS3A01G532200 chr3D 82.584 867 140 8 2092 2953 610685057 610684197 0.000000e+00 754.0
10 TraesCS3A01G532200 chr3D 84.323 606 77 14 305 903 610686800 610686206 8.930000e-161 577.0
11 TraesCS3A01G532200 chr3D 85.094 530 72 6 294 816 610561562 610561033 5.450000e-148 534.0
12 TraesCS3A01G532200 chr3D 83.130 575 80 13 1230 1789 610629026 610628454 3.300000e-140 508.0
13 TraesCS3A01G532200 chr3D 80.296 609 104 8 1448 2047 610685653 610685052 2.630000e-121 446.0
14 TraesCS3A01G532200 chr3D 88.800 250 23 3 902 1146 610686169 610685920 6.020000e-78 302.0
15 TraesCS3A01G532200 chr3D 93.478 92 5 1 1140 1230 610629176 610629085 6.460000e-28 135.0
16 TraesCS3A01G532200 chr3B 87.008 1524 188 6 1424 2945 828254311 828252796 0.000000e+00 1709.0
17 TraesCS3A01G532200 chr3B 87.598 895 68 22 267 1128 828256818 828255934 0.000000e+00 998.0
18 TraesCS3A01G532200 chr3B 80.508 1180 190 17 1445 2609 828332453 828331299 0.000000e+00 869.0
19 TraesCS3A01G532200 chr3B 84.307 873 91 27 301 1128 828294554 828293683 0.000000e+00 811.0
20 TraesCS3A01G532200 chr3B 86.074 596 71 9 312 899 828333538 828332947 6.760000e-177 630.0
21 TraesCS3A01G532200 chr3B 84.219 621 76 16 3084 3687 828330983 828330368 5.340000e-163 584.0
22 TraesCS3A01G532200 chr3B 83.703 632 86 11 3088 3705 828287155 828286527 6.900000e-162 580.0
23 TraesCS3A01G532200 chr3B 92.095 253 12 4 902 1146 828332905 828332653 2.120000e-92 350.0
24 TraesCS3A01G532200 chr3B 84.825 257 31 6 2751 3000 828331241 828330986 6.150000e-63 252.0
25 TraesCS3A01G532200 chr3B 92.553 94 6 1 89 182 828257188 828257096 2.320000e-27 134.0
26 TraesCS3A01G532200 chr7D 91.837 49 3 1 1354 1401 19418740 19418692 2.390000e-07 67.6
27 TraesCS3A01G532200 chr5B 78.409 88 19 0 3405 3492 64295043 64294956 1.440000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G532200 chr3A 745191727 745195434 3707 True 6848.00 6848 100.00000 1 3708 1 chr3A.!!$R4 3707
1 TraesCS3A01G532200 chr3A 745078523 745082231 3708 True 6732.00 6732 99.43400 1 3708 1 chr3A.!!$R3 3707
2 TraesCS3A01G532200 chr3A 745011714 745015451 3737 True 6466.00 6466 98.02300 1 3708 1 chr3A.!!$R2 3707
3 TraesCS3A01G532200 chr3A 744939397 744942524 3127 True 5262.00 5262 97.19100 1 3098 1 chr3A.!!$R1 3097
4 TraesCS3A01G532200 chr3A 745296674 745299444 2770 True 1197.50 2080 88.23800 915 3700 2 chr3A.!!$R5 2785
5 TraesCS3A01G532200 chr3D 610666609 610668064 1455 True 1147.00 1147 81.11600 1528 3000 1 chr3D.!!$R2 1472
6 TraesCS3A01G532200 chr3D 610626450 610630159 3709 True 943.75 2156 87.30725 180 3706 4 chr3D.!!$R3 3526
7 TraesCS3A01G532200 chr3D 610561033 610561562 529 True 534.00 534 85.09400 294 816 1 chr3D.!!$R1 522
8 TraesCS3A01G532200 chr3D 610684197 610686800 2603 True 519.75 754 84.00075 305 2953 4 chr3D.!!$R4 2648
9 TraesCS3A01G532200 chr3B 828252796 828257188 4392 True 947.00 1709 89.05300 89 2945 3 chr3B.!!$R3 2856
10 TraesCS3A01G532200 chr3B 828293683 828294554 871 True 811.00 811 84.30700 301 1128 1 chr3B.!!$R2 827
11 TraesCS3A01G532200 chr3B 828286527 828287155 628 True 580.00 580 83.70300 3088 3705 1 chr3B.!!$R1 617
12 TraesCS3A01G532200 chr3B 828330368 828333538 3170 True 537.00 869 85.54420 312 3687 5 chr3B.!!$R4 3375

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
43 44 4.846779 TTGCGCTTCTATTTTTGTCCTT 57.153 36.364 9.73 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2741 4591 9.97475 GAACAAATGTTGATCTAAACTAGCTAC 57.025 33.333 3.05 0.0 38.56 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 4.846779 TTGCGCTTCTATTTTTGTCCTT 57.153 36.364 9.73 0.0 0.00 3.36
166 167 7.043565 GGTCGTATAAATTTCACTAGGTTGGA 58.956 38.462 0.00 0.0 0.00 3.53
189 219 9.656040 TGGAAATCAAATCATCCAAATAAACTG 57.344 29.630 0.00 0.0 38.95 3.16
2068 3905 2.365635 AGCCGCTACTGGACCCAT 60.366 61.111 0.00 0.0 0.00 4.00
2437 4275 0.321653 ACGGGATGGAGCAGTTGTTC 60.322 55.000 0.00 0.0 0.00 3.18
2741 4591 4.980590 TCGCAATGCAACTTGTAATTAGG 58.019 39.130 5.91 0.0 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
607 809 4.229096 CCACCGCATAATTAATCATGCAC 58.771 43.478 20.95 0.0 46.32 4.57
2741 4591 9.974750 GAACAAATGTTGATCTAAACTAGCTAC 57.025 33.333 3.05 0.0 38.56 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.