Multiple sequence alignment - TraesCS3A01G502500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G502500 chr3A 100.000 2440 0 0 1 2440 725798351 725795912 0 4506
1 TraesCS3A01G502500 chr7D 98.323 2445 36 4 1 2440 381925604 381923160 0 4283
2 TraesCS3A01G502500 chr7D 98.200 2445 37 5 1 2440 382051682 382049240 0 4265
3 TraesCS3A01G502500 chr7D 98.119 2445 40 5 1 2440 203501602 203499159 0 4255
4 TraesCS3A01G502500 chr7D 98.076 2443 37 5 1 2440 381972167 381974602 0 4242
5 TraesCS3A01G502500 chr6D 98.240 2443 40 3 1 2440 124519125 124516683 0 4270
6 TraesCS3A01G502500 chr5A 98.082 2450 37 6 1 2440 19247240 19249689 0 4255
7 TraesCS3A01G502500 chr7A 97.874 2446 46 4 1 2440 60280916 60278471 0 4224
8 TraesCS3A01G502500 chr7A 97.791 2444 48 5 1 2440 120839557 120841998 0 4209
9 TraesCS3A01G502500 chr7B 97.875 2447 42 6 1 2440 716877178 716879621 0 4222


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G502500 chr3A 725795912 725798351 2439 True 4506 4506 100.000 1 2440 1 chr3A.!!$R1 2439
1 TraesCS3A01G502500 chr7D 381923160 381925604 2444 True 4283 4283 98.323 1 2440 1 chr7D.!!$R2 2439
2 TraesCS3A01G502500 chr7D 382049240 382051682 2442 True 4265 4265 98.200 1 2440 1 chr7D.!!$R3 2439
3 TraesCS3A01G502500 chr7D 203499159 203501602 2443 True 4255 4255 98.119 1 2440 1 chr7D.!!$R1 2439
4 TraesCS3A01G502500 chr7D 381972167 381974602 2435 False 4242 4242 98.076 1 2440 1 chr7D.!!$F1 2439
5 TraesCS3A01G502500 chr6D 124516683 124519125 2442 True 4270 4270 98.240 1 2440 1 chr6D.!!$R1 2439
6 TraesCS3A01G502500 chr5A 19247240 19249689 2449 False 4255 4255 98.082 1 2440 1 chr5A.!!$F1 2439
7 TraesCS3A01G502500 chr7A 60278471 60280916 2445 True 4224 4224 97.874 1 2440 1 chr7A.!!$R1 2439
8 TraesCS3A01G502500 chr7A 120839557 120841998 2441 False 4209 4209 97.791 1 2440 1 chr7A.!!$F1 2439
9 TraesCS3A01G502500 chr7B 716877178 716879621 2443 False 4222 4222 97.875 1 2440 1 chr7B.!!$F1 2439

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
959 961 0.108138 GTAGATGCCGAACCTGCTGT 60.108 55.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2171 2188 2.561478 TCGCTTTAGCTTCCAAAGGT 57.439 45.0 9.04 0.0 42.74 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 3.565482 CCCAACGACCTATAACGCTAGTA 59.435 47.826 0.00 0.0 0.00 1.82
151 152 4.857037 GCGGCGAAGAACAAATAGAATTTT 59.143 37.500 12.98 0.0 0.00 1.82
279 280 1.982660 TATTTGACACGGGTTTGCCA 58.017 45.000 0.00 0.0 36.17 4.92
360 361 9.533831 ACCAATTAGTAGTGATTGAATTCCTTT 57.466 29.630 14.88 0.0 35.74 3.11
591 592 3.004752 AGGCGCAATAGAAAGGAATGT 57.995 42.857 10.83 0.0 0.00 2.71
780 782 7.298854 GGAAGGACTTATTCTCAACGAAAAAG 58.701 38.462 0.00 0.0 34.79 2.27
790 792 4.038763 TCTCAACGAAAAAGGTGCTCTCTA 59.961 41.667 0.00 0.0 0.00 2.43
824 826 2.504367 AGTTGTTTTCCATCAGACGGG 58.496 47.619 0.00 0.0 0.00 5.28
846 848 2.953648 TGTTCACGTAACTCCACTCTCA 59.046 45.455 0.00 0.0 38.99 3.27
959 961 0.108138 GTAGATGCCGAACCTGCTGT 60.108 55.000 0.00 0.0 0.00 4.40
1023 1025 1.896660 GTTGCCAGCACTTTCCCGA 60.897 57.895 0.00 0.0 0.00 5.14
1105 1107 1.271379 CCTCGGCCTTCTTCCTTTTCA 60.271 52.381 0.00 0.0 0.00 2.69
1135 1137 5.089970 ACAAATCGACATCTCAATCTCCA 57.910 39.130 0.00 0.0 0.00 3.86
1139 1141 7.040478 ACAAATCGACATCTCAATCTCCAAAAA 60.040 33.333 0.00 0.0 0.00 1.94
1140 1142 7.636150 AATCGACATCTCAATCTCCAAAAAT 57.364 32.000 0.00 0.0 0.00 1.82
1159 1161 6.590234 AAAATGTTTTCCTTACCCAGCTAG 57.410 37.500 0.00 0.0 0.00 3.42
1279 1281 3.129287 GGTGAACATAGGCTCAAACATGG 59.871 47.826 0.00 0.0 0.00 3.66
1429 1433 2.288886 CGACTTTCTTTCTTCCTCCCGT 60.289 50.000 0.00 0.0 0.00 5.28
1533 1537 2.231478 TCTTCGCGAGAACTTCAGGATT 59.769 45.455 9.59 0.0 46.92 3.01
2064 2081 9.013229 TCAGTAGCAAACATATTCATTTTCACT 57.987 29.630 0.00 0.0 0.00 3.41
2171 2188 0.037590 CCGGAAAGGTCATTGGGTCA 59.962 55.000 0.00 0.0 34.51 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 1.717194 CGTTAGCCGGCTTTTGTAGA 58.283 50.000 37.74 12.41 0.00 2.59
279 280 3.769739 TCGCCATAGTTCCAGCATTAT 57.230 42.857 0.00 0.00 0.00 1.28
360 361 4.991776 TGGTTTCTCATGTGGAACCATAA 58.008 39.130 28.95 12.87 34.36 1.90
780 782 2.450609 TGTTCGGTTTAGAGAGCACC 57.549 50.000 0.00 0.00 0.00 5.01
790 792 5.579119 GGAAAACAACTTTCATGTTCGGTTT 59.421 36.000 0.00 0.00 44.61 3.27
824 826 3.243301 TGAGAGTGGAGTTACGTGAACAC 60.243 47.826 0.00 0.39 40.86 3.32
906 908 2.380084 TCCACTTCAGATAACCACGC 57.620 50.000 0.00 0.00 0.00 5.34
1023 1025 7.195818 TCTTATAAAGAATTCCGGCTCGGCT 62.196 44.000 0.65 0.00 39.83 5.52
1044 1046 1.507141 CTTTGCCTGCCGACGTTCTT 61.507 55.000 0.00 0.00 0.00 2.52
1075 1077 2.524394 GGCCGAGGGGATAGCAGA 60.524 66.667 0.00 0.00 34.06 4.26
1105 1107 9.132521 GATTGAGATGTCGATTTGTTTTTCATT 57.867 29.630 0.00 0.00 0.00 2.57
1135 1137 5.887214 AGCTGGGTAAGGAAAACATTTTT 57.113 34.783 0.00 0.00 0.00 1.94
1139 1141 4.929146 ACTAGCTGGGTAAGGAAAACAT 57.071 40.909 0.85 0.00 0.00 2.71
1140 1142 5.104652 GGATACTAGCTGGGTAAGGAAAACA 60.105 44.000 0.85 0.00 0.00 2.83
1279 1281 1.121378 GTAGCTAGGACCCCTCCAAC 58.879 60.000 0.00 0.00 39.39 3.77
1533 1537 0.253044 CCCTTCCGAATGCTTCTCCA 59.747 55.000 0.00 0.00 0.00 3.86
1746 1752 5.411053 GCAATTTAGAGAGAAAGAGCAGTGT 59.589 40.000 0.00 0.00 0.00 3.55
2171 2188 2.561478 TCGCTTTAGCTTCCAAAGGT 57.439 45.000 9.04 0.00 42.74 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.