Multiple sequence alignment - TraesCS3A01G502400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G502400 chr3A 100.000 1880 0 0 436 2315 725777194 725775315 0.000000e+00 3472
1 TraesCS3A01G502400 chr3A 100.000 251 0 0 1 251 725777629 725777379 4.510000e-127 464
2 TraesCS3A01G502400 chr5A 98.138 1880 35 0 436 2315 238860138 238862017 0.000000e+00 3278
3 TraesCS3A01G502400 chr5A 97.926 1880 36 2 436 2315 238829341 238827465 0.000000e+00 3253
4 TraesCS3A01G502400 chr5A 98.805 251 3 0 1 251 238829603 238829353 4.540000e-122 448
5 TraesCS3A01G502400 chr1A 97.500 1880 47 0 436 2315 334091541 334093420 0.000000e+00 3212
6 TraesCS3A01G502400 chr6A 97.447 1880 48 0 436 2315 155845465 155847344 0.000000e+00 3206
7 TraesCS3A01G502400 chr6A 96.591 1848 58 5 470 2315 375870538 375868694 0.000000e+00 3059
8 TraesCS3A01G502400 chr6B 96.810 1881 57 3 436 2315 388040066 388038188 0.000000e+00 3138
9 TraesCS3A01G502400 chr2D 98.618 1664 23 0 436 2099 644701947 644703610 0.000000e+00 2946
10 TraesCS3A01G502400 chr2D 98.406 251 4 0 1 251 644701684 644701934 2.110000e-120 442
11 TraesCS3A01G502400 chrUn 98.498 1664 25 0 436 2099 45099475 45101138 0.000000e+00 2935
12 TraesCS3A01G502400 chrUn 98.440 1667 26 0 436 2102 261514381 261512715 0.000000e+00 2935
13 TraesCS3A01G502400 chrUn 97.778 405 9 0 1911 2315 396261046 396261450 0.000000e+00 699
14 TraesCS3A01G502400 chrUn 98.805 251 3 0 1 251 45099216 45099466 4.540000e-122 448
15 TraesCS3A01G502400 chrUn 98.805 251 3 0 1 251 261514642 261514392 4.540000e-122 448
16 TraesCS3A01G502400 chrUn 98.406 251 4 0 1 251 186162206 186162456 2.110000e-120 442
17 TraesCS3A01G502400 chr7D 97.778 405 9 0 1911 2315 579000902 579000498 0.000000e+00 699
18 TraesCS3A01G502400 chr4D 97.778 405 9 0 1911 2315 241377397 241377801 0.000000e+00 699
19 TraesCS3A01G502400 chr7B 98.805 251 3 0 1 251 743035277 743035027 4.540000e-122 448
20 TraesCS3A01G502400 chr5B 98.805 251 3 0 1 251 130608301 130608551 4.540000e-122 448
21 TraesCS3A01G502400 chr5B 98.805 251 3 0 1 251 130613325 130613575 4.540000e-122 448
22 TraesCS3A01G502400 chr1D 98.406 251 4 0 1 251 493802876 493803126 2.110000e-120 442


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G502400 chr3A 725775315 725777629 2314 True 1968.0 3472 100.0000 1 2315 2 chr3A.!!$R1 2314
1 TraesCS3A01G502400 chr5A 238860138 238862017 1879 False 3278.0 3278 98.1380 436 2315 1 chr5A.!!$F1 1879
2 TraesCS3A01G502400 chr5A 238827465 238829603 2138 True 1850.5 3253 98.3655 1 2315 2 chr5A.!!$R1 2314
3 TraesCS3A01G502400 chr1A 334091541 334093420 1879 False 3212.0 3212 97.5000 436 2315 1 chr1A.!!$F1 1879
4 TraesCS3A01G502400 chr6A 155845465 155847344 1879 False 3206.0 3206 97.4470 436 2315 1 chr6A.!!$F1 1879
5 TraesCS3A01G502400 chr6A 375868694 375870538 1844 True 3059.0 3059 96.5910 470 2315 1 chr6A.!!$R1 1845
6 TraesCS3A01G502400 chr6B 388038188 388040066 1878 True 3138.0 3138 96.8100 436 2315 1 chr6B.!!$R1 1879
7 TraesCS3A01G502400 chr2D 644701684 644703610 1926 False 1694.0 2946 98.5120 1 2099 2 chr2D.!!$F1 2098
8 TraesCS3A01G502400 chrUn 45099216 45101138 1922 False 1691.5 2935 98.6515 1 2099 2 chrUn.!!$F3 2098
9 TraesCS3A01G502400 chrUn 261512715 261514642 1927 True 1691.5 2935 98.6225 1 2102 2 chrUn.!!$R1 2101

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
163 164 0.321564 TCGGTCGGTCCTAGAAACGA 60.322 55.0 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1644 1650 0.251787 GTTGGGCACTGGATCCCTTT 60.252 55.0 9.9 0.0 43.04 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
143 144 2.674033 GTGCATGCAGGTGAGGCA 60.674 61.111 23.41 0.00 46.66 4.75
163 164 0.321564 TCGGTCGGTCCTAGAAACGA 60.322 55.000 0.00 0.00 0.00 3.85
515 517 1.102154 CCGCCAATTCTATTGCACCA 58.898 50.000 0.00 0.00 0.00 4.17
666 669 4.821805 CCAAGACAAGATACAACTGTTGGT 59.178 41.667 23.15 12.18 34.12 3.67
730 733 1.077716 GTGGCGCCCATTCCTAACT 60.078 57.895 26.77 0.00 35.28 2.24
1644 1650 0.757561 TCACACGTTCTCCAGGTCCA 60.758 55.000 0.00 0.00 0.00 4.02
1837 1843 0.668096 CACCTACGCGCTGGTAAACA 60.668 55.000 20.66 0.00 34.79 2.83
2008 2014 5.510349 CCGCCTATCTTTCTGATCTCATTCA 60.510 44.000 0.00 0.00 36.65 2.57
2015 2021 8.818622 ATCTTTCTGATCTCATTCATTTTCCA 57.181 30.769 0.00 0.00 0.00 3.53
2269 2275 5.188555 GCCTTACTTTACTAACAGGTAGGGT 59.811 44.000 0.00 0.00 33.85 4.34
2272 2278 3.905591 ACTTTACTAACAGGTAGGGTGCA 59.094 43.478 0.00 0.00 33.68 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
143 144 0.737219 CGTTTCTAGGACCGACCGAT 59.263 55.000 0.00 0.00 44.74 4.18
163 164 1.333636 AACTCCTCGCTAGCTGCCAT 61.334 55.000 13.93 0.00 38.78 4.40
515 517 2.288579 TGTATGTTCGACTTCGGTTGCT 60.289 45.455 0.00 0.00 40.29 3.91
564 567 1.378762 CCGCCCTTTCTTTCCTCCA 59.621 57.895 0.00 0.00 0.00 3.86
666 669 5.911178 AGGTTCTATTGATCATGTCCCCTTA 59.089 40.000 0.00 0.00 0.00 2.69
730 733 4.330944 TGAGCGAACCTTTTCAGAACTA 57.669 40.909 0.00 0.00 0.00 2.24
774 777 1.067212 GTGAACTAGCGGACCGATCAT 59.933 52.381 20.50 0.00 0.00 2.45
1001 1005 2.824936 CACATCAAAATGGTACCAGCCA 59.175 45.455 21.41 2.53 43.48 4.75
1334 1340 7.062749 TCGATTGCCCTAGAATTACAACTAT 57.937 36.000 0.00 0.00 0.00 2.12
1561 1567 3.366052 TGAAGTATCAGGCCCCTTTTC 57.634 47.619 0.00 0.00 0.00 2.29
1644 1650 0.251787 GTTGGGCACTGGATCCCTTT 60.252 55.000 9.90 0.00 43.04 3.11
1702 1708 3.382546 GTGTCCACTAACGGCTATTCCTA 59.617 47.826 0.00 0.00 0.00 2.94
1763 1769 7.364673 GGCCCCTGTGAACATATTTTCTTAATT 60.365 37.037 0.00 0.00 0.00 1.40
1837 1843 0.399075 ATCCGGTCGAGGTGGTTTTT 59.601 50.000 0.00 0.00 0.00 1.94
2008 2014 8.034215 TCATGACTTTTTATGCGATTGGAAAAT 58.966 29.630 0.00 0.00 0.00 1.82
2015 2021 7.558161 TGATCTCATGACTTTTTATGCGATT 57.442 32.000 0.00 0.00 31.11 3.34
2086 2092 8.786898 TCATGATTTAAGAACAAGAGAACAAGG 58.213 33.333 0.00 0.00 0.00 3.61
2172 2178 1.450531 ATGGACGTCGATCCGGTACC 61.451 60.000 9.92 0.16 42.24 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.