Multiple sequence alignment - TraesCS3A01G501600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G501600 chr3A 100.000 2363 0 0 1 2363 725552813 725555175 0.000000e+00 4364
1 TraesCS3A01G501600 chr3A 99.788 2363 4 1 1 2363 725595362 725597723 0.000000e+00 4335
2 TraesCS3A01G501600 chr3A 97.812 320 7 0 634 953 636689977 636689658 9.540000e-154 553
3 TraesCS3A01G501600 chr3A 81.416 226 36 4 1142 1361 725524314 725524539 1.870000e-41 180
4 TraesCS3A01G501600 chr3A 81.416 226 36 4 1142 1361 725566004 725566229 1.870000e-41 180
5 TraesCS3A01G501600 chr3A 81.416 226 36 4 1142 1361 725608335 725608560 1.870000e-41 180
6 TraesCS3A01G501600 chr3D 92.226 1415 70 15 956 2363 594769739 594771120 0.000000e+00 1967
7 TraesCS3A01G501600 chr3D 89.876 484 29 5 130 613 594769231 594769694 2.600000e-169 604
8 TraesCS3A01G501600 chr3D 84.973 559 50 13 1296 1826 594634854 594635406 9.610000e-149 536
9 TraesCS3A01G501600 chr3D 82.343 623 59 26 1023 1618 594748867 594749465 5.870000e-136 494
10 TraesCS3A01G501600 chr3D 79.402 301 54 5 1142 1438 594802696 594802992 3.080000e-49 206
11 TraesCS3A01G501600 chr3D 83.516 182 24 6 168 344 594745898 594746078 5.220000e-37 165
12 TraesCS3A01G501600 chr3B 95.550 1236 39 8 950 2178 798229767 798230993 0.000000e+00 1964
13 TraesCS3A01G501600 chr3B 93.638 503 24 6 130 632 798229274 798229768 0.000000e+00 745
14 TraesCS3A01G501600 chr3B 77.178 241 46 7 1136 1367 798251994 798252234 5.300000e-27 132
15 TraesCS3A01G501600 chr7B 91.304 322 25 3 634 953 322395932 322396252 1.000000e-118 436
16 TraesCS3A01G501600 chr6D 91.277 321 27 1 634 953 459281412 459281092 1.000000e-118 436
17 TraesCS3A01G501600 chr1B 91.277 321 27 1 634 953 30488045 30488365 1.000000e-118 436
18 TraesCS3A01G501600 chr1B 91.277 321 27 1 634 953 30500389 30500709 1.000000e-118 436
19 TraesCS3A01G501600 chr1B 82.639 144 17 7 2106 2249 659573379 659573514 1.150000e-23 121
20 TraesCS3A01G501600 chr1B 83.333 120 17 3 1 118 35380109 35379991 8.930000e-20 108
21 TraesCS3A01G501600 chr2D 91.022 323 26 2 634 953 3954189 3954511 1.300000e-117 433
22 TraesCS3A01G501600 chr2D 90.402 323 28 2 634 953 4016383 4016705 2.810000e-114 422
23 TraesCS3A01G501600 chr2D 80.916 131 22 3 1 129 102278289 102278160 1.490000e-17 100
24 TraesCS3A01G501600 chr4B 90.966 321 28 1 634 953 514068435 514068115 4.670000e-117 431
25 TraesCS3A01G501600 chr4B 85.938 128 15 3 2106 2231 122314234 122314108 1.470000e-27 134
26 TraesCS3A01G501600 chr4B 78.077 260 24 10 2103 2360 665569765 665569993 1.470000e-27 134
27 TraesCS3A01G501600 chr7D 80.233 258 19 12 2103 2360 553381062 553381287 5.220000e-37 165
28 TraesCS3A01G501600 chr7D 83.333 120 19 1 1 119 199080685 199080566 2.480000e-20 110
29 TraesCS3A01G501600 chr7A 90.351 114 9 2 2106 2219 75073007 75073118 5.260000e-32 148
30 TraesCS3A01G501600 chr7A 87.719 114 8 3 2255 2363 75073124 75073236 6.850000e-26 128
31 TraesCS3A01G501600 chrUn 88.696 115 11 2 2106 2219 331923059 331923172 3.170000e-29 139
32 TraesCS3A01G501600 chrUn 88.696 115 11 2 2106 2219 331951307 331951420 3.170000e-29 139
33 TraesCS3A01G501600 chrUn 88.696 115 11 2 2106 2219 464230304 464230417 3.170000e-29 139
34 TraesCS3A01G501600 chr6B 85.926 135 13 6 2229 2363 279050914 279051042 3.170000e-29 139
35 TraesCS3A01G501600 chr5A 88.073 109 9 2 2255 2360 705572925 705573032 2.470000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G501600 chr3A 725552813 725555175 2362 False 4364.0 4364 100.0000 1 2363 1 chr3A.!!$F2 2362
1 TraesCS3A01G501600 chr3A 725595362 725597723 2361 False 4335.0 4335 99.7880 1 2363 1 chr3A.!!$F4 2362
2 TraesCS3A01G501600 chr3D 594769231 594771120 1889 False 1285.5 1967 91.0510 130 2363 2 chr3D.!!$F4 2233
3 TraesCS3A01G501600 chr3D 594634854 594635406 552 False 536.0 536 84.9730 1296 1826 1 chr3D.!!$F1 530
4 TraesCS3A01G501600 chr3D 594745898 594749465 3567 False 329.5 494 82.9295 168 1618 2 chr3D.!!$F3 1450
5 TraesCS3A01G501600 chr3B 798229274 798230993 1719 False 1354.5 1964 94.5940 130 2178 2 chr3B.!!$F2 2048

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
88 89 8.797266 AAATTAAAGAAACTGCTAAAACGGAG 57.203 30.769 0.0 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2335 4864 7.509986 CGTCAATCGTTATTTTCATCGCTTTTC 60.51 37.037 0.0 0.0 34.52 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
88 89 8.797266 AAATTAAAGAAACTGCTAAAACGGAG 57.203 30.769 0.0 0.0 0.0 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.589492 GGAATGCGAGACGATGGCG 61.589 63.158 0.0 0.0 44.79 5.69
2335 4864 7.509986 CGTCAATCGTTATTTTCATCGCTTTTC 60.510 37.037 0.0 0.0 34.52 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.