Multiple sequence alignment - TraesCS3A01G491800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G491800 chr3A 100.000 2579 0 0 1 2579 718994175 718991597 0 4763
1 TraesCS3A01G491800 chr6B 96.824 2582 78 4 1 2579 388359044 388356464 0 4311
2 TraesCS3A01G491800 chr6B 96.474 2581 84 6 1 2578 388166989 388164413 0 4255
3 TraesCS3A01G491800 chr7B 96.745 2581 81 3 1 2579 531994931 531997510 0 4298
4 TraesCS3A01G491800 chr2B 96.668 2581 82 4 1 2579 751961809 751959231 0 4287
5 TraesCS3A01G491800 chr2B 95.201 1667 38 10 915 2579 112852584 112854210 0 2597
6 TraesCS3A01G491800 chr3B 95.199 2583 118 6 1 2579 575746126 575743546 0 4078
7 TraesCS3A01G491800 chr7A 96.804 2347 64 9 237 2579 708264393 708262054 0 3908
8 TraesCS3A01G491800 chr4B 95.606 2276 90 7 302 2576 547038351 547040617 0 3640
9 TraesCS3A01G491800 chr5D 96.223 2224 74 8 358 2579 244894244 244896459 0 3633
10 TraesCS3A01G491800 chr5D 95.749 2023 79 5 1 2020 79846320 79844302 0 3253


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G491800 chr3A 718991597 718994175 2578 True 4763 4763 100.000 1 2579 1 chr3A.!!$R1 2578
1 TraesCS3A01G491800 chr6B 388356464 388359044 2580 True 4311 4311 96.824 1 2579 1 chr6B.!!$R2 2578
2 TraesCS3A01G491800 chr6B 388164413 388166989 2576 True 4255 4255 96.474 1 2578 1 chr6B.!!$R1 2577
3 TraesCS3A01G491800 chr7B 531994931 531997510 2579 False 4298 4298 96.745 1 2579 1 chr7B.!!$F1 2578
4 TraesCS3A01G491800 chr2B 751959231 751961809 2578 True 4287 4287 96.668 1 2579 1 chr2B.!!$R1 2578
5 TraesCS3A01G491800 chr2B 112852584 112854210 1626 False 2597 2597 95.201 915 2579 1 chr2B.!!$F1 1664
6 TraesCS3A01G491800 chr3B 575743546 575746126 2580 True 4078 4078 95.199 1 2579 1 chr3B.!!$R1 2578
7 TraesCS3A01G491800 chr7A 708262054 708264393 2339 True 3908 3908 96.804 237 2579 1 chr7A.!!$R1 2342
8 TraesCS3A01G491800 chr4B 547038351 547040617 2266 False 3640 3640 95.606 302 2576 1 chr4B.!!$F1 2274
9 TraesCS3A01G491800 chr5D 244894244 244896459 2215 False 3633 3633 96.223 358 2579 1 chr5D.!!$F1 2221
10 TraesCS3A01G491800 chr5D 79844302 79846320 2018 True 3253 3253 95.749 1 2020 1 chr5D.!!$R1 2019

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
932 937 1.726533 GGGAAAAACCAACGCCGACA 61.727 55.0 0.0 0.0 41.2 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1770 1781 1.643811 CCTAAAATGGAGGGGTTGGGA 59.356 52.381 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 184 7.881751 AGCAGCACATCATACATATTTCTACAT 59.118 33.333 0.00 0.00 0.00 2.29
245 249 7.455008 TCCATTCCACCTTTATCTATCTAGGTC 59.545 40.741 0.00 0.00 38.93 3.85
273 277 7.502226 TCCTTCTTTCTTAACAAAGCAGAATGA 59.498 33.333 4.83 0.00 38.34 2.57
297 301 7.681598 TGAGATGATTGATCCCTCTATTATGGT 59.318 37.037 0.00 0.00 0.00 3.55
418 422 5.094387 TCTTTCATCCTCCTTACCAGAACT 58.906 41.667 0.00 0.00 0.00 3.01
932 937 1.726533 GGGAAAAACCAACGCCGACA 61.727 55.000 0.00 0.00 41.20 4.35
966 971 5.009110 GTCTCCTTTCCTTTCAAAAGTGAGG 59.991 44.000 2.09 5.94 34.84 3.86
998 1003 5.586643 GCTGAAAAAGATGGAGTTACCTAGG 59.413 44.000 7.41 7.41 39.86 3.02
1083 1089 3.057969 TGTGCATCAAGTCCGAAGAAT 57.942 42.857 0.00 0.00 0.00 2.40
1152 1158 4.876107 GGCTTTCTCATATTCAGTCGGAAA 59.124 41.667 0.00 0.00 39.39 3.13
1183 1189 7.565680 AGGTAAGACTTTCAAAGAAACTCTCA 58.434 34.615 3.49 0.00 0.00 3.27
1271 1277 4.280677 GGAGGAATCCAATGAACAACAACA 59.719 41.667 0.61 0.00 0.00 3.33
1632 1641 1.539280 GCTAACAGAAGAGCGGATCCC 60.539 57.143 6.06 0.00 0.00 3.85
1651 1660 7.467267 CGGATCCCATACACATAAGACTTTTTG 60.467 40.741 6.06 0.00 0.00 2.44
1770 1781 0.185901 TTTGAGCCTGGAGCCAAAGT 59.814 50.000 0.00 0.00 45.47 2.66
1865 1878 4.141018 ACGGCTCCATATTTATTTTCCCCT 60.141 41.667 0.00 0.00 0.00 4.79
2054 2067 4.261405 CCTCGTTTTTCCATTAAGTGTGCA 60.261 41.667 0.00 0.00 0.00 4.57
2124 2137 0.178533 ACCGTCCGGACTTGAAACAA 59.821 50.000 30.92 0.00 38.96 2.83
2290 2303 5.592587 TGGGAAAAAGGAAGGAGTAATCA 57.407 39.130 0.00 0.00 0.00 2.57
2394 2407 4.177537 TCTGATCCCCTTGTTTTTCACA 57.822 40.909 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 149 3.920231 TGATGTGCTGCTAGGAAATCT 57.080 42.857 0.00 0.00 32.17 2.40
245 249 7.206981 TCTGCTTTGTTAAGAAAGAAGGATG 57.793 36.000 25.46 8.06 38.65 3.51
273 277 9.741198 ATACCATAATAGAGGGATCAATCATCT 57.259 33.333 0.00 0.00 31.54 2.90
387 391 6.154706 GGTAAGGAGGATGAAAGAAGAGTACA 59.845 42.308 0.00 0.00 0.00 2.90
418 422 7.745717 TCTTATTCTTCTGAACCAGGAAAAGA 58.254 34.615 0.00 0.00 34.71 2.52
912 917 2.050805 CGGCGTTGGTTTTTCCCG 60.051 61.111 0.00 0.00 34.77 5.14
913 918 1.008194 GTCGGCGTTGGTTTTTCCC 60.008 57.895 6.85 0.00 34.77 3.97
932 937 6.013032 TGAAAGGAAAGGAGACTGATCTTGAT 60.013 38.462 0.00 0.00 42.68 2.57
966 971 2.422832 CCATCTTTTTCAGCTCTGCTCC 59.577 50.000 0.00 0.00 36.40 4.70
998 1003 8.307483 TCATATCCGTAGAAAGAAATCTCATCC 58.693 37.037 0.00 0.00 0.00 3.51
1183 1189 3.952323 TGAATAGACTCGATTCTCCCGTT 59.048 43.478 8.76 1.14 34.88 4.44
1271 1277 5.023533 TCGCAAGCTGATCCTAAGTAATT 57.976 39.130 0.00 0.00 37.18 1.40
1770 1781 1.643811 CCTAAAATGGAGGGGTTGGGA 59.356 52.381 0.00 0.00 0.00 4.37
2054 2067 5.126067 CCCCGTTATTCTTCATCAGACAAT 58.874 41.667 0.00 0.00 0.00 2.71
2327 2340 3.017265 TGAAGTCCGTTTCCTTCGTAC 57.983 47.619 0.00 0.00 39.93 3.67
2394 2407 3.604875 TTCCTCTTCCGAATTAAGCGT 57.395 42.857 0.00 0.00 0.00 5.07
2560 2573 2.263153 GCCGTTTACCAATGCACCT 58.737 52.632 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.