Multiple sequence alignment - TraesCS3A01G484500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G484500 chr3A 100.000 2643 0 0 1 2643 714222433 714225075 0.000000e+00 4881
1 TraesCS3A01G484500 chr7A 97.880 2642 54 1 4 2643 21044140 21041499 0.000000e+00 4567
2 TraesCS3A01G484500 chr7A 97.163 2644 51 3 4 2643 688928650 688931273 0.000000e+00 4446
3 TraesCS3A01G484500 chr5A 97.807 2645 53 3 1 2643 663200068 663202709 0.000000e+00 4558
4 TraesCS3A01G484500 chr5A 97.314 2643 67 3 4 2643 100350419 100347778 0.000000e+00 4484
5 TraesCS3A01G484500 chr1A 97.615 2642 58 4 4 2643 577613553 577610915 0.000000e+00 4525
6 TraesCS3A01G484500 chr3B 97.388 2642 62 4 4 2643 778356449 778353813 0.000000e+00 4490
7 TraesCS3A01G484500 chr3B 95.627 343 15 0 1 343 62349508 62349850 3.840000e-153 551
8 TraesCS3A01G484500 chr6A 97.237 2642 65 5 4 2643 562226310 562223675 0.000000e+00 4468
9 TraesCS3A01G484500 chrUn 97.406 2082 54 0 562 2643 308012124 308010043 0.000000e+00 3546
10 TraesCS3A01G484500 chrUn 97.406 2082 54 0 562 2643 308106821 308108902 0.000000e+00 3546
11 TraesCS3A01G484500 chrUn 97.406 2082 54 0 562 2643 323644452 323646533 0.000000e+00 3546
12 TraesCS3A01G484500 chr2B 95.335 343 16 0 1 343 681388379 681388721 1.790000e-151 545


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G484500 chr3A 714222433 714225075 2642 False 4881 4881 100.000 1 2643 1 chr3A.!!$F1 2642
1 TraesCS3A01G484500 chr7A 21041499 21044140 2641 True 4567 4567 97.880 4 2643 1 chr7A.!!$R1 2639
2 TraesCS3A01G484500 chr7A 688928650 688931273 2623 False 4446 4446 97.163 4 2643 1 chr7A.!!$F1 2639
3 TraesCS3A01G484500 chr5A 663200068 663202709 2641 False 4558 4558 97.807 1 2643 1 chr5A.!!$F1 2642
4 TraesCS3A01G484500 chr5A 100347778 100350419 2641 True 4484 4484 97.314 4 2643 1 chr5A.!!$R1 2639
5 TraesCS3A01G484500 chr1A 577610915 577613553 2638 True 4525 4525 97.615 4 2643 1 chr1A.!!$R1 2639
6 TraesCS3A01G484500 chr3B 778353813 778356449 2636 True 4490 4490 97.388 4 2643 1 chr3B.!!$R1 2639
7 TraesCS3A01G484500 chr6A 562223675 562226310 2635 True 4468 4468 97.237 4 2643 1 chr6A.!!$R1 2639
8 TraesCS3A01G484500 chrUn 308010043 308012124 2081 True 3546 3546 97.406 562 2643 1 chrUn.!!$R1 2081
9 TraesCS3A01G484500 chrUn 308106821 308108902 2081 False 3546 3546 97.406 562 2643 1 chrUn.!!$F1 2081
10 TraesCS3A01G484500 chrUn 323644452 323646533 2081 False 3546 3546 97.406 562 2643 1 chrUn.!!$F2 2081

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
895 922 0.036732 CTAGCAACAAGGTGCCAGGA 59.963 55.0 6.45 0.0 46.14 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1700 1727 2.427245 CCTCTCGCCACGGATCCTT 61.427 63.158 10.75 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 4.030452 GTCGCCAAGCCACAGCAC 62.030 66.667 0.00 0.00 43.56 4.40
214 217 2.127869 CCCGCTACCTGCTCTGCTA 61.128 63.158 0.00 0.00 40.11 3.49
245 248 5.789521 TGCTACTTCATTGTGCTTGTACTA 58.210 37.500 0.00 0.00 0.00 1.82
285 288 1.638589 TGATTCCTTCCCGGGACATTT 59.361 47.619 26.87 7.34 34.78 2.32
436 439 4.156556 TCTGAATTGTATCAACTTGCCAGC 59.843 41.667 0.00 0.00 0.00 4.85
672 678 7.667043 TTCGAGTGAACAAACTATGCTAAAT 57.333 32.000 0.00 0.00 0.00 1.40
895 922 0.036732 CTAGCAACAAGGTGCCAGGA 59.963 55.000 6.45 0.00 46.14 3.86
979 1006 5.747565 TGACTATGTTCTGTTTTTGCTTCG 58.252 37.500 0.00 0.00 0.00 3.79
991 1018 2.642154 TTGCTTCGGGTAAACCAAGA 57.358 45.000 0.81 0.00 40.22 3.02
1094 1121 7.088589 AGGTTTGTGACTGCAATATTGATAC 57.911 36.000 19.73 9.61 0.00 2.24
1172 1199 1.620822 ACCTCAACCTTCATTGCCAC 58.379 50.000 0.00 0.00 0.00 5.01
1275 1302 0.613853 ACAGGCTGCCCGTAAGTCTA 60.614 55.000 16.57 0.00 35.76 2.59
1320 1347 2.053865 CCTCACCGTTACCGCCCTA 61.054 63.158 0.00 0.00 0.00 3.53
1355 1382 5.823570 TCTTCGGTGTGTAAAATCTTCCAAA 59.176 36.000 0.00 0.00 0.00 3.28
1446 1473 1.899814 AGTGAGATCCGCAAGTACCAA 59.100 47.619 0.00 0.00 0.00 3.67
1528 1555 4.338879 CCAGGACTTCAAGGTGATCAATT 58.661 43.478 0.00 0.00 0.00 2.32
1622 1649 2.050144 ACCATCCTGTTCTGTCTGTGT 58.950 47.619 0.00 0.00 0.00 3.72
1761 1788 2.670148 GGGAATGTCTCTGGCGGGT 61.670 63.158 0.00 0.00 0.00 5.28
1823 1850 7.849804 TTGGAACTGCTAGCTCTAATTTAAG 57.150 36.000 17.23 3.77 0.00 1.85
1852 1879 1.692411 GTTCCCCTGTTTCTGCTGTT 58.308 50.000 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 2.202440 CGAACGACGCACCGATCT 60.202 61.111 0.00 0.00 34.51 2.75
214 217 4.273480 GCACAATGAAGTAGCATACCGAAT 59.727 41.667 0.00 0.00 44.47 3.34
245 248 8.695456 GGAATCACCAGAAATTTTACCACATAT 58.305 33.333 0.00 0.00 38.79 1.78
285 288 6.166279 CCTCTCAGCTTCACACAACTAAATA 58.834 40.000 0.00 0.00 0.00 1.40
436 439 9.869844 GTGCACATGATTTTAGTAATTAGCTAG 57.130 33.333 13.17 0.00 0.00 3.42
672 678 6.438741 ACTTCAGATGAAAGTCCTGATCTACA 59.561 38.462 0.00 0.00 36.88 2.74
979 1006 4.864704 TGAGCAAAATCTTGGTTTACCC 57.135 40.909 0.00 0.00 43.24 3.69
1172 1199 7.398618 ACATCAGTAGGATATCTGGTCATAAGG 59.601 40.741 2.05 0.00 33.95 2.69
1320 1347 1.139058 ACACCGAAGAGCAACAGTTCT 59.861 47.619 0.00 0.00 0.00 3.01
1528 1555 5.334802 GCATCACAATGTAGTGCACAAGTTA 60.335 40.000 21.04 0.00 41.55 2.24
1622 1649 2.504585 TCTAGAAGCGGAGGTCAGTCTA 59.495 50.000 0.00 0.00 37.06 2.59
1700 1727 2.427245 CCTCTCGCCACGGATCCTT 61.427 63.158 10.75 0.00 0.00 3.36
1761 1788 2.485426 GCAGCAAAAGCAGACACAGATA 59.515 45.455 0.00 0.00 0.00 1.98
1823 1850 3.397849 AACAGGGGAACGAGAAGTAAC 57.602 47.619 0.00 0.00 0.00 2.50
1852 1879 6.274322 ACCTAAATTGCCATGGGAATACTA 57.726 37.500 29.30 21.35 35.12 1.82
2455 2484 4.640201 GCTAGTTTCCAGCAATATCCAACA 59.360 41.667 0.00 0.00 38.93 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.