Multiple sequence alignment - TraesCS3A01G476400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G476400 chr3A 100.000 3374 0 0 1 3374 707819095 707815722 0.000000e+00 6231.0
1 TraesCS3A01G476400 chr3A 99.497 3378 12 3 1 3374 707758325 707754949 0.000000e+00 6139.0
2 TraesCS3A01G476400 chr3A 99.259 3376 22 2 1 3374 707728507 707725133 0.000000e+00 6093.0
3 TraesCS3A01G476400 chr3A 99.314 3352 19 3 1 3350 707789682 707786333 0.000000e+00 6059.0
4 TraesCS3A01G476400 chr3A 99.403 2849 15 1 528 3374 707694799 707691951 0.000000e+00 5166.0
5 TraesCS3A01G476400 chr3A 99.111 2474 17 1 906 3374 707905998 707903525 0.000000e+00 4442.0
6 TraesCS3A01G476400 chr3A 99.316 877 2 2 528 1400 707660401 707659525 0.000000e+00 1583.0
7 TraesCS3A01G476400 chr3A 98.954 669 7 0 2706 3374 707658384 707657716 0.000000e+00 1197.0
8 TraesCS3A01G476400 chr3A 98.885 538 3 3 1 537 707695518 707694983 0.000000e+00 957.0
9 TraesCS3A01G476400 chr3A 98.282 524 8 1 1 524 707660983 707660461 0.000000e+00 917.0
10 TraesCS3A01G476400 chr3A 90.059 674 62 5 2704 3374 629049263 629048592 0.000000e+00 869.0
11 TraesCS3A01G476400 chr3A 90.506 474 41 3 1997 2469 707920163 707919693 1.030000e-174 623.0
12 TraesCS3A01G476400 chr3A 89.583 96 9 1 2604 2698 707919112 707919017 1.640000e-23 121.0
13 TraesCS3A01G476400 chr3A 85.586 111 8 5 671 773 707925193 707925083 3.560000e-20 110.0
14 TraesCS3A01G476400 chr3D 93.515 1912 102 13 671 2577 573204895 573203001 0.000000e+00 2824.0
15 TraesCS3A01G476400 chr3D 88.296 1256 114 17 1235 2486 573263674 573262448 0.000000e+00 1474.0
16 TraesCS3A01G476400 chr3D 92.542 295 20 2 3081 3374 560326037 560326330 4.030000e-114 422.0
17 TraesCS3A01G476400 chr3D 90.476 126 12 0 2573 2698 573202782 573202657 2.080000e-37 167.0
18 TraesCS3A01G476400 chr3D 85.294 102 7 3 680 773 573264155 573264054 7.700000e-17 99.0
19 TraesCS3A01G476400 chrUn 99.759 1246 3 0 1908 3153 420729280 420730525 0.000000e+00 2285.0
20 TraesCS3A01G476400 chr3B 87.011 1278 118 25 1235 2511 762734196 762732966 0.000000e+00 1397.0
21 TraesCS3A01G476400 chr3B 89.286 672 69 3 2704 3374 744582174 744582843 0.000000e+00 839.0
22 TraesCS3A01G476400 chr3B 93.396 106 7 0 2510 2615 762732801 762732696 1.250000e-34 158.0
23 TraesCS3A01G476400 chr3B 86.842 114 6 5 667 773 762734665 762734554 5.910000e-23 119.0
24 TraesCS3A01G476400 chr1B 83.527 1202 131 32 1033 2213 426905832 426904677 0.000000e+00 1061.0
25 TraesCS3A01G476400 chr1B 85.714 126 15 2 551 673 426902934 426903059 2.730000e-26 130.0
26 TraesCS3A01G476400 chr1B 90.909 66 6 0 2491 2556 426903181 426903116 4.640000e-14 89.8
27 TraesCS3A01G476400 chr1B 92.188 64 3 1 1824 1885 426905021 426904958 4.640000e-14 89.8
28 TraesCS3A01G476400 chr2A 95.541 471 18 2 1 471 288985513 288985046 0.000000e+00 750.0
29 TraesCS3A01G476400 chr2A 93.843 471 24 2 3 473 38628380 38628845 0.000000e+00 704.0
30 TraesCS3A01G476400 chr6A 91.736 484 26 4 1 471 459671053 459670571 0.000000e+00 660.0
31 TraesCS3A01G476400 chr7B 89.627 482 39 3 1 472 701020211 701019731 1.340000e-168 603.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G476400 chr3A 707815722 707819095 3373 True 6231.000000 6231 100.000000 1 3374 1 chr3A.!!$R5 3373
1 TraesCS3A01G476400 chr3A 707754949 707758325 3376 True 6139.000000 6139 99.497000 1 3374 1 chr3A.!!$R3 3373
2 TraesCS3A01G476400 chr3A 707725133 707728507 3374 True 6093.000000 6093 99.259000 1 3374 1 chr3A.!!$R2 3373
3 TraesCS3A01G476400 chr3A 707786333 707789682 3349 True 6059.000000 6059 99.314000 1 3350 1 chr3A.!!$R4 3349
4 TraesCS3A01G476400 chr3A 707903525 707905998 2473 True 4442.000000 4442 99.111000 906 3374 1 chr3A.!!$R6 2468
5 TraesCS3A01G476400 chr3A 707691951 707695518 3567 True 3061.500000 5166 99.144000 1 3374 2 chr3A.!!$R9 3373
6 TraesCS3A01G476400 chr3A 707657716 707660983 3267 True 1232.333333 1583 98.850667 1 3374 3 chr3A.!!$R8 3373
7 TraesCS3A01G476400 chr3A 629048592 629049263 671 True 869.000000 869 90.059000 2704 3374 1 chr3A.!!$R1 670
8 TraesCS3A01G476400 chr3A 707919017 707920163 1146 True 372.000000 623 90.044500 1997 2698 2 chr3A.!!$R10 701
9 TraesCS3A01G476400 chr3D 573202657 573204895 2238 True 1495.500000 2824 91.995500 671 2698 2 chr3D.!!$R1 2027
10 TraesCS3A01G476400 chr3D 573262448 573264155 1707 True 786.500000 1474 86.795000 680 2486 2 chr3D.!!$R2 1806
11 TraesCS3A01G476400 chrUn 420729280 420730525 1245 False 2285.000000 2285 99.759000 1908 3153 1 chrUn.!!$F1 1245
12 TraesCS3A01G476400 chr3B 744582174 744582843 669 False 839.000000 839 89.286000 2704 3374 1 chr3B.!!$F1 670
13 TraesCS3A01G476400 chr3B 762732696 762734665 1969 True 558.000000 1397 89.083000 667 2615 3 chr3B.!!$R1 1948
14 TraesCS3A01G476400 chr1B 426903116 426905832 2716 True 413.533333 1061 88.874667 1033 2556 3 chr1B.!!$R1 1523

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
526 530 3.264193 TGGGTCTTGCTATATATGGCCAG 59.736 47.826 17.41 15.61 32.8 4.85 F
1781 2359 6.286240 AGGGAATTTACTGGATTGCTTTTC 57.714 37.500 0.00 0.00 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1781 2359 9.281371 ACATTGGAGATACATGATGACAAATAG 57.719 33.333 0.0 0.0 0.0 1.73 R
3175 6007 3.454375 CTTGCTTCCATCCAATTCATGC 58.546 45.455 0.0 0.0 0.0 4.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
526 530 3.264193 TGGGTCTTGCTATATATGGCCAG 59.736 47.826 17.41 15.61 32.80 4.85
1781 2359 6.286240 AGGGAATTTACTGGATTGCTTTTC 57.714 37.500 0.00 0.00 0.00 2.29
3175 6007 4.379394 CGTGTCCCCACATTCATGTTAAAG 60.379 45.833 0.00 0.00 41.93 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1781 2359 9.281371 ACATTGGAGATACATGATGACAAATAG 57.719 33.333 0.0 0.0 0.0 1.73
3175 6007 3.454375 CTTGCTTCCATCCAATTCATGC 58.546 45.455 0.0 0.0 0.0 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.