Multiple sequence alignment - TraesCS3A01G470500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G470500 chr3A 100.000 2270 0 0 1 2270 702488506 702486237 0.000000e+00 4193
1 TraesCS3A01G470500 chr3A 93.042 1624 91 12 33 1649 737723350 737721742 0.000000e+00 2353
2 TraesCS3A01G470500 chr3A 86.935 819 52 18 1498 2268 80570853 80571664 0.000000e+00 869
3 TraesCS3A01G470500 chr3A 94.884 215 8 2 2055 2268 737720945 737720733 1.300000e-87 333
4 TraesCS3A01G470500 chr5A 90.684 2340 115 35 3 2268 573790852 573793162 0.000000e+00 3018
5 TraesCS3A01G470500 chr5A 89.853 1764 119 27 3 1722 459479521 459477774 0.000000e+00 2211
6 TraesCS3A01G470500 chr5A 94.256 853 34 7 872 1720 676814183 676815024 0.000000e+00 1290
7 TraesCS3A01G470500 chr5A 93.158 190 10 2 2055 2243 676815257 676815444 2.220000e-70 276
8 TraesCS3A01G470500 chr6A 90.287 2337 119 37 1 2268 21600974 21603271 0.000000e+00 2959
9 TraesCS3A01G470500 chr7A 89.465 2335 138 33 1 2268 118423943 118426236 0.000000e+00 2850
10 TraesCS3A01G470500 chr7A 91.282 1732 97 29 1 1723 58357841 58359527 0.000000e+00 2313
11 TraesCS3A01G470500 chr7A 92.699 1534 92 9 40 1570 735980090 735978574 0.000000e+00 2194
12 TraesCS3A01G470500 chr7A 89.793 1499 114 12 3 1493 201968654 201970121 0.000000e+00 1884
13 TraesCS3A01G470500 chr7A 89.264 1509 113 22 1 1493 538560161 538558686 0.000000e+00 1844
14 TraesCS3A01G470500 chr7A 85.567 582 39 15 1730 2268 201970435 201971014 3.270000e-158 568
15 TraesCS3A01G470500 chr7A 93.458 214 11 2 2056 2268 735977791 735977580 4.710000e-82 315
16 TraesCS3A01G470500 chr1A 93.876 1731 79 8 1 1724 564250751 564252461 0.000000e+00 2584
17 TraesCS3A01G470500 chr1A 91.013 1569 66 38 1 1563 564261140 564259641 0.000000e+00 2047
18 TraesCS3A01G470500 chr1A 89.761 1504 100 22 254 1721 514986894 514985409 0.000000e+00 1875
19 TraesCS3A01G470500 chr1A 92.730 784 41 10 1498 2268 564259250 564258470 0.000000e+00 1118
20 TraesCS3A01G470500 chr1A 92.357 785 38 14 1498 2268 564252379 564253155 0.000000e+00 1098
21 TraesCS3A01G470500 chr1A 86.520 816 53 19 1498 2267 514736866 514736062 0.000000e+00 845
22 TraesCS3A01G470500 chr1A 86.902 794 49 26 1498 2246 514985485 514984702 0.000000e+00 839
23 TraesCS3A01G470500 chr1A 86.632 778 61 24 1498 2243 515250335 515249569 0.000000e+00 821
24 TraesCS3A01G470500 chr2A 91.218 1503 107 13 1 1496 767478044 767476560 0.000000e+00 2021
25 TraesCS3A01G470500 chr2A 93.851 683 25 6 1584 2264 161587421 161586754 0.000000e+00 1013
26 TraesCS3A01G470500 chr2A 93.953 215 10 2 2055 2268 52603319 52603107 2.810000e-84 322
27 TraesCS3A01G470500 chr4A 92.109 1318 76 10 334 1648 29434408 29435700 0.000000e+00 1832
28 TraesCS3A01G470500 chr4A 92.117 888 57 5 606 1493 66536002 66536876 0.000000e+00 1240
29 TraesCS3A01G470500 chr4A 93.862 668 28 5 1599 2264 556009526 556008870 0.000000e+00 994
30 TraesCS3A01G470500 chr4A 93.981 216 8 4 2055 2268 29436546 29436758 2.810000e-84 322
31 TraesCS3A01G470500 chr7D 89.958 478 30 9 1584 2052 54727322 54726854 3.230000e-168 601
32 TraesCS3A01G470500 chr3D 88.075 478 39 12 1584 2052 2336742 2336274 3.300000e-153 551
33 TraesCS3A01G470500 chr5D 85.081 496 49 12 1567 2052 41231257 41231737 1.220000e-132 483
34 TraesCS3A01G470500 chr6B 85.270 482 50 10 1582 2052 18198435 18197964 5.670000e-131 477


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G470500 chr3A 702486237 702488506 2269 True 4193.0 4193 100.0000 1 2270 1 chr3A.!!$R1 2269
1 TraesCS3A01G470500 chr3A 737720733 737723350 2617 True 1343.0 2353 93.9630 33 2268 2 chr3A.!!$R2 2235
2 TraesCS3A01G470500 chr3A 80570853 80571664 811 False 869.0 869 86.9350 1498 2268 1 chr3A.!!$F1 770
3 TraesCS3A01G470500 chr5A 573790852 573793162 2310 False 3018.0 3018 90.6840 3 2268 1 chr5A.!!$F1 2265
4 TraesCS3A01G470500 chr5A 459477774 459479521 1747 True 2211.0 2211 89.8530 3 1722 1 chr5A.!!$R1 1719
5 TraesCS3A01G470500 chr5A 676814183 676815444 1261 False 783.0 1290 93.7070 872 2243 2 chr5A.!!$F2 1371
6 TraesCS3A01G470500 chr6A 21600974 21603271 2297 False 2959.0 2959 90.2870 1 2268 1 chr6A.!!$F1 2267
7 TraesCS3A01G470500 chr7A 118423943 118426236 2293 False 2850.0 2850 89.4650 1 2268 1 chr7A.!!$F2 2267
8 TraesCS3A01G470500 chr7A 58357841 58359527 1686 False 2313.0 2313 91.2820 1 1723 1 chr7A.!!$F1 1722
9 TraesCS3A01G470500 chr7A 538558686 538560161 1475 True 1844.0 1844 89.2640 1 1493 1 chr7A.!!$R1 1492
10 TraesCS3A01G470500 chr7A 735977580 735980090 2510 True 1254.5 2194 93.0785 40 2268 2 chr7A.!!$R2 2228
11 TraesCS3A01G470500 chr7A 201968654 201971014 2360 False 1226.0 1884 87.6800 3 2268 2 chr7A.!!$F3 2265
12 TraesCS3A01G470500 chr1A 564250751 564253155 2404 False 1841.0 2584 93.1165 1 2268 2 chr1A.!!$F1 2267
13 TraesCS3A01G470500 chr1A 564258470 564261140 2670 True 1582.5 2047 91.8715 1 2268 2 chr1A.!!$R4 2267
14 TraesCS3A01G470500 chr1A 514984702 514986894 2192 True 1357.0 1875 88.3315 254 2246 2 chr1A.!!$R3 1992
15 TraesCS3A01G470500 chr1A 514736062 514736866 804 True 845.0 845 86.5200 1498 2267 1 chr1A.!!$R1 769
16 TraesCS3A01G470500 chr1A 515249569 515250335 766 True 821.0 821 86.6320 1498 2243 1 chr1A.!!$R2 745
17 TraesCS3A01G470500 chr2A 767476560 767478044 1484 True 2021.0 2021 91.2180 1 1496 1 chr2A.!!$R3 1495
18 TraesCS3A01G470500 chr2A 161586754 161587421 667 True 1013.0 1013 93.8510 1584 2264 1 chr2A.!!$R2 680
19 TraesCS3A01G470500 chr4A 66536002 66536876 874 False 1240.0 1240 92.1170 606 1493 1 chr4A.!!$F1 887
20 TraesCS3A01G470500 chr4A 29434408 29436758 2350 False 1077.0 1832 93.0450 334 2268 2 chr4A.!!$F2 1934
21 TraesCS3A01G470500 chr4A 556008870 556009526 656 True 994.0 994 93.8620 1599 2264 1 chr4A.!!$R1 665

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
869 952 1.320344 ATCGCCGAGTCCAGCAGTAA 61.32 55.0 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1727 3027 0.041135 CGTGGCGGCGTTCTTTTTAA 60.041 50.0 9.37 0.0 0.0 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 212 2.338620 CTCCGTCGGCTCACACAA 59.661 61.111 6.34 0.0 0.00 3.33
238 269 2.049063 GTGTCGTCCTCTTGCGCT 60.049 61.111 9.73 0.0 0.00 5.92
275 306 2.757917 GTGCCTCTCCCTCTCGCT 60.758 66.667 0.00 0.0 0.00 4.93
302 333 3.047877 CCGCCCCAACTTGACGAC 61.048 66.667 0.00 0.0 0.00 4.34
851 934 3.395702 TACGGCGGGCAGGAACAT 61.396 61.111 13.24 0.0 0.00 2.71
865 948 2.835701 GAACATCGCCGAGTCCAGCA 62.836 60.000 0.00 0.0 0.00 4.41
869 952 1.320344 ATCGCCGAGTCCAGCAGTAA 61.320 55.000 0.00 0.0 0.00 2.24
1814 3321 2.671963 GGGAACGCTTTTCGGCCT 60.672 61.111 0.00 0.0 43.86 5.19
1892 3407 0.036765 GATCACGTTGGTGTAGGGCA 60.037 55.000 0.00 0.0 44.68 5.36
1915 3432 1.395608 GCGCTATTTAAACTGGTGCGA 59.604 47.619 19.00 0.0 43.81 5.10
2134 3715 2.173143 TGGTTTCGTTTAGTCCCACCTT 59.827 45.455 0.00 0.0 0.00 3.50
2140 3721 1.420532 TTTAGTCCCACCTTGCCCGT 61.421 55.000 0.00 0.0 0.00 5.28
2268 3850 3.357079 GCTGCCCGGACAGTGTTG 61.357 66.667 19.65 0.0 39.96 3.33
2269 3851 2.425592 CTGCCCGGACAGTGTTGA 59.574 61.111 10.01 0.0 32.78 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 207 2.426023 GAGGCGAGGGTGTTGTGT 59.574 61.111 0.00 0.00 0.00 3.72
222 253 1.806461 AAGAGCGCAAGAGGACGACA 61.806 55.000 11.47 0.00 43.02 4.35
238 269 4.717629 CGCGCGAGGTGGTGAAGA 62.718 66.667 28.94 0.00 0.00 2.87
857 940 2.261671 CCGCGTTACTGCTGGACT 59.738 61.111 4.92 0.00 32.62 3.85
865 948 2.047560 GTTCCTGCCCGCGTTACT 60.048 61.111 4.92 0.00 0.00 2.24
1236 1358 2.989253 TCGCCGAAGTCTGCCTCA 60.989 61.111 0.00 0.00 0.00 3.86
1723 3023 3.491639 GTGGCGGCGTTCTTTTTAAAAAT 59.508 39.130 13.55 0.00 0.00 1.82
1724 3024 2.858941 GTGGCGGCGTTCTTTTTAAAAA 59.141 40.909 12.62 12.62 0.00 1.94
1725 3025 2.461903 GTGGCGGCGTTCTTTTTAAAA 58.538 42.857 9.37 0.00 0.00 1.52
1726 3026 1.597445 CGTGGCGGCGTTCTTTTTAAA 60.597 47.619 9.37 0.00 0.00 1.52
1727 3027 0.041135 CGTGGCGGCGTTCTTTTTAA 60.041 50.000 9.37 0.00 0.00 1.52
1728 3028 1.570475 CGTGGCGGCGTTCTTTTTA 59.430 52.632 9.37 0.00 0.00 1.52
1892 3407 2.365582 CACCAGTTTAAATAGCGCCCT 58.634 47.619 2.29 0.00 0.00 5.19
1925 3442 3.602075 TAGTCCCACCTCGCCTGCT 62.602 63.158 0.00 0.00 0.00 4.24
2140 3721 3.379445 GGTCTGGGCGTCCTTCGA 61.379 66.667 7.97 0.00 42.86 3.71
2175 3756 4.349048 TCTTATCTGCTAGGGTGCATGAAT 59.651 41.667 0.00 0.00 42.48 2.57
2176 3757 3.711190 TCTTATCTGCTAGGGTGCATGAA 59.289 43.478 0.00 0.00 42.48 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.