Multiple sequence alignment - TraesCS3A01G469600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G469600 chr3A 100.000 2282 0 0 1 2282 701989680 701987399 0 4215
1 TraesCS3A01G469600 chr3A 96.538 2282 78 1 1 2282 701981814 701979534 0 3775
2 TraesCS3A01G469600 chr4A 96.516 1349 44 3 9 1357 85922188 85923533 0 2228
3 TraesCS3A01G469600 chr4A 96.000 1350 50 4 9 1357 85954401 85955747 0 2191
4 TraesCS3A01G469600 chr4A 90.774 943 71 15 1347 2282 273716627 273715694 0 1245
5 TraesCS3A01G469600 chr5A 96.131 1344 50 2 12 1355 268822474 268821133 0 2193
6 TraesCS3A01G469600 chr5A 95.259 1371 60 5 12 1380 268814500 268813133 0 2167
7 TraesCS3A01G469600 chr5A 90.774 943 71 15 1347 2282 288789968 288789035 0 1245
8 TraesCS3A01G469600 chr5A 90.668 943 71 15 1347 2282 59428776 59429708 0 1238
9 TraesCS3A01G469600 chr5A 90.456 943 74 15 1347 2282 79324484 79325417 0 1229
10 TraesCS3A01G469600 chr5A 90.138 943 77 15 1347 2282 59420750 59421683 0 1212
11 TraesCS3A01G469600 chr2A 95.784 1352 54 3 7 1357 352651389 352652738 0 2178
12 TraesCS3A01G469600 chr2A 95.263 1351 61 3 7 1357 352643379 352644726 0 2137
13 TraesCS3A01G469600 chr6A 95.276 1376 58 7 7 1380 216935628 216934258 0 2174
14 TraesCS3A01G469600 chr1A 95.407 1350 59 3 9 1357 201752140 201753487 0 2146
15 TraesCS3A01G469600 chr1A 90.350 943 75 15 1347 2282 86896455 86897388 0 1223
16 TraesCS3A01G469600 chr1A 90.254 944 74 17 1347 2282 184256393 184257326 0 1218
17 TraesCS3A01G469600 chr1A 90.032 943 77 16 1347 2282 86861052 86861984 0 1205


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G469600 chr3A 701987399 701989680 2281 True 4215 4215 100.000 1 2282 1 chr3A.!!$R2 2281
1 TraesCS3A01G469600 chr3A 701979534 701981814 2280 True 3775 3775 96.538 1 2282 1 chr3A.!!$R1 2281
2 TraesCS3A01G469600 chr4A 85922188 85923533 1345 False 2228 2228 96.516 9 1357 1 chr4A.!!$F1 1348
3 TraesCS3A01G469600 chr4A 85954401 85955747 1346 False 2191 2191 96.000 9 1357 1 chr4A.!!$F2 1348
4 TraesCS3A01G469600 chr4A 273715694 273716627 933 True 1245 1245 90.774 1347 2282 1 chr4A.!!$R1 935
5 TraesCS3A01G469600 chr5A 268821133 268822474 1341 True 2193 2193 96.131 12 1355 1 chr5A.!!$R2 1343
6 TraesCS3A01G469600 chr5A 268813133 268814500 1367 True 2167 2167 95.259 12 1380 1 chr5A.!!$R1 1368
7 TraesCS3A01G469600 chr5A 288789035 288789968 933 True 1245 1245 90.774 1347 2282 1 chr5A.!!$R3 935
8 TraesCS3A01G469600 chr5A 59428776 59429708 932 False 1238 1238 90.668 1347 2282 1 chr5A.!!$F2 935
9 TraesCS3A01G469600 chr5A 79324484 79325417 933 False 1229 1229 90.456 1347 2282 1 chr5A.!!$F3 935
10 TraesCS3A01G469600 chr5A 59420750 59421683 933 False 1212 1212 90.138 1347 2282 1 chr5A.!!$F1 935
11 TraesCS3A01G469600 chr2A 352651389 352652738 1349 False 2178 2178 95.784 7 1357 1 chr2A.!!$F2 1350
12 TraesCS3A01G469600 chr2A 352643379 352644726 1347 False 2137 2137 95.263 7 1357 1 chr2A.!!$F1 1350
13 TraesCS3A01G469600 chr6A 216934258 216935628 1370 True 2174 2174 95.276 7 1380 1 chr6A.!!$R1 1373
14 TraesCS3A01G469600 chr1A 201752140 201753487 1347 False 2146 2146 95.407 9 1357 1 chr1A.!!$F4 1348
15 TraesCS3A01G469600 chr1A 86896455 86897388 933 False 1223 1223 90.350 1347 2282 1 chr1A.!!$F2 935
16 TraesCS3A01G469600 chr1A 184256393 184257326 933 False 1218 1218 90.254 1347 2282 1 chr1A.!!$F3 935
17 TraesCS3A01G469600 chr1A 86861052 86861984 932 False 1205 1205 90.032 1347 2282 1 chr1A.!!$F1 935

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
465 467 0.817634 CTCTCGATCTCTCCCAGCGT 60.818 60.0 0.0 0.0 0.0 5.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1360 1365 0.108615 CTTGTCGGTCCGATCTTGCT 60.109 55.0 18.75 0.0 38.42 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 7.951806 TGCCCATATATCCTTTCATCATTTTCT 59.048 33.333 0.00 0.00 0.00 2.52
225 227 1.307309 CCATGCCCAGATTCCACCA 59.693 57.895 0.00 0.00 0.00 4.17
236 238 1.210722 GATTCCACCACTTCCTCCTCC 59.789 57.143 0.00 0.00 0.00 4.30
465 467 0.817634 CTCTCGATCTCTCCCAGCGT 60.818 60.000 0.00 0.00 0.00 5.07
577 580 1.961791 CCTCTCGATCTCGCGCCTA 60.962 63.158 0.00 0.00 39.60 3.93
931 935 2.507452 CAGCATCGATCCCCAGCA 59.493 61.111 7.34 0.00 0.00 4.41
996 1000 1.299976 GGAACCGCATCCTTCCACT 59.700 57.895 0.00 0.00 36.66 4.00
1229 1234 1.544246 CGACTACATATCCGGGATGCA 59.456 52.381 19.82 0.33 0.00 3.96
1360 1365 3.225104 ACGACCTTGTACAACTACTCCA 58.775 45.455 3.59 0.00 0.00 3.86
1448 1453 5.113446 AGTCATCTAGTACCTCTCCGAAA 57.887 43.478 0.00 0.00 0.00 3.46
1488 1493 2.296471 CCGCTACTATCGAACCCAATCT 59.704 50.000 0.00 0.00 0.00 2.40
1498 1503 3.253188 TCGAACCCAATCTGCTTTGAAAG 59.747 43.478 0.00 0.00 0.00 2.62
1724 1729 6.603237 TGCATCGGTATCTCAATTAAGTTG 57.397 37.500 0.00 0.00 39.25 3.16
1858 1865 9.528018 TTTTTCCTAAACTTGCATAAACTTGAG 57.472 29.630 0.00 0.00 0.00 3.02
1979 1987 2.865079 TGTTCCGGCCTCATTTAAACA 58.135 42.857 0.00 0.00 0.00 2.83
2039 2047 8.986847 TCTTGCCATGTTAACAAACATTTAATG 58.013 29.630 13.23 3.07 41.12 1.90
2069 2077 6.318144 TGAGTACCTAACCAAGATCGAACTAG 59.682 42.308 0.00 0.00 0.00 2.57
2155 2163 4.400884 TGTAGGATTGTTTGTGCACTTTGT 59.599 37.500 19.41 0.00 0.00 2.83
2247 2256 6.975772 TGGTTGTTTACTATGTTGTTTGCTTC 59.024 34.615 0.00 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 1.146774 TGGATTTTTGGTGGAGCTCCA 59.853 47.619 32.00 32.00 45.30 3.86
225 227 5.371176 AGAAAGAAAAGAAGGAGGAGGAAGT 59.629 40.000 0.00 0.00 0.00 3.01
931 935 1.617947 GGAGGCAGGAAGGTGACGAT 61.618 60.000 0.00 0.00 0.00 3.73
1229 1234 1.278127 CTTGACGGTGGGGTACTTGAT 59.722 52.381 0.00 0.00 0.00 2.57
1360 1365 0.108615 CTTGTCGGTCCGATCTTGCT 60.109 55.000 18.75 0.00 38.42 3.91
1448 1453 2.288030 CGGAAGTAGTGGTTCACGTTCT 60.288 50.000 0.00 0.00 39.64 3.01
1488 1493 0.819259 AGCGTGCCTCTTTCAAAGCA 60.819 50.000 0.00 0.00 0.00 3.91
1498 1503 0.389426 TACCTTTCGAAGCGTGCCTC 60.389 55.000 0.00 0.00 0.00 4.70
1724 1729 2.281276 AACGTTCCGGTTCCCAGC 60.281 61.111 0.00 0.00 0.00 4.85
1838 1844 7.272084 GTCATGCTCAAGTTTATGCAAGTTTAG 59.728 37.037 0.00 0.00 38.96 1.85
1858 1865 3.767287 CATGATGCGGATGTCATGC 57.233 52.632 7.46 0.00 43.45 4.06
1997 2005 3.887716 GGCAAGAGGTGAAGCATATGAAT 59.112 43.478 6.97 0.00 0.00 2.57
2039 2047 5.347907 CGATCTTGGTTAGGTACTCAACAAC 59.652 44.000 10.79 1.55 41.75 3.32
2069 2077 5.997385 ACGAAACACCACATTCAAGTTATC 58.003 37.500 0.00 0.00 0.00 1.75
2155 2163 4.518590 CCGGTTTAATGATACATGGCATGA 59.481 41.667 32.74 16.92 0.00 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.